Incidental Mutation 'R7529:Cfap65'
ID 583162
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission 045601-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.677) question?
Stock # R7529 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 74941230-74974758 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74965769 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 414 (N414D)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably damaging
Transcript: ENSMUST00000094844
AA Change: N414D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: N414D

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T A 7: 127,836,336 (GRCm39) K86* probably null Het
Ablim3 A C 18: 61,955,039 (GRCm39) S317A probably benign Het
Adcy1 T C 11: 7,089,157 (GRCm39) S524P probably damaging Het
Agps C A 2: 75,662,696 (GRCm39) A47E possibly damaging Het
Arhgef15 G T 11: 68,844,848 (GRCm39) R250S probably damaging Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Atoh8 G T 6: 72,200,825 (GRCm39) D288E probably benign Het
B3galt2 A C 1: 143,522,274 (GRCm39) K137Q probably benign Het
Cacna2d4 G A 6: 119,247,727 (GRCm39) V343I probably benign Het
Cage1 T C 13: 38,209,731 (GRCm39) N82S possibly damaging Het
Cep350 A G 1: 155,737,669 (GRCm39) S2725P probably benign Het
Cgnl1 A C 9: 71,539,040 (GRCm39) L1154R probably damaging Het
Cmya5 A T 13: 93,233,942 (GRCm39) M382K probably benign Het
Dchs2 G A 3: 83,261,705 (GRCm39) V2658M possibly damaging Het
Dlgap5 T C 14: 47,653,876 (GRCm39) N51S probably damaging Het
Dnah17 A G 11: 117,940,692 (GRCm39) probably null Het
Dnal1 A G 12: 84,178,117 (GRCm39) I35V probably benign Het
Dtnbp1 A G 13: 45,084,546 (GRCm39) F198S probably damaging Het
Edar A T 10: 58,447,830 (GRCm39) S160T probably benign Het
Enpp3 A T 10: 24,674,072 (GRCm39) N409K probably damaging Het
Ercc6 T A 14: 32,282,686 (GRCm39) C726* probably null Het
Extl2 G A 3: 115,821,055 (GRCm39) V301I possibly damaging Het
G2e3 A G 12: 51,418,387 (GRCm39) Q594R probably damaging Het
Gal3st2c A G 1: 93,937,039 (GRCm39) N328S probably benign Het
Galnt17 A G 5: 131,335,218 (GRCm39) V74A probably damaging Het
Ggta1 A G 2: 35,304,256 (GRCm39) W76R probably damaging Het
Gm9772 T A 17: 22,226,140 (GRCm39) D48V probably benign Het
Herpud2 T C 9: 25,020,193 (GRCm39) T388A probably damaging Het
Ighv5-9-1 A G 12: 113,699,954 (GRCm39) S53P possibly damaging Het
Il23r T A 6: 67,467,720 (GRCm39) M16L possibly damaging Het
Ints1 G A 5: 139,753,481 (GRCm39) A717V possibly damaging Het
Itpr2 A T 6: 146,096,096 (GRCm39) L2122Q probably damaging Het
Klrg2 A T 6: 38,607,266 (GRCm39) V248E probably damaging Het
Krtap5-5 A G 7: 141,783,429 (GRCm39) C74R unknown Het
Luzp1 G T 4: 136,268,243 (GRCm39) L155F probably damaging Het
Mcam T C 9: 44,050,192 (GRCm39) V209A probably benign Het
Med1 G C 11: 98,046,791 (GRCm39) T1335R unknown Het
Mroh2b A G 15: 4,978,491 (GRCm39) I1346V probably damaging Het
Mrpl4 C G 9: 20,918,975 (GRCm39) Q201E probably benign Het
Muc21 A T 17: 35,930,123 (GRCm39) S1354R unknown Het
Mylk2 T C 2: 152,757,624 (GRCm39) L326P probably damaging Het
Myot A T 18: 44,479,240 (GRCm39) R326* probably null Het
Nox3 T A 17: 3,722,050 (GRCm39) R288S probably damaging Het
Nox4 A T 7: 87,044,976 (GRCm39) Y572F unknown Het
Or2v2 A G 11: 49,003,686 (GRCm39) L289P probably damaging Het
Or5an10 A G 19: 12,276,086 (GRCm39) S137P probably damaging Het
Pcdhb15 G T 18: 37,607,526 (GRCm39) E253* probably null Het
Plcb2 T C 2: 118,540,715 (GRCm39) H1052R probably damaging Het
Plpp5 A T 8: 26,214,233 (GRCm39) Q250L probably benign Het
Plxna2 T C 1: 194,326,179 (GRCm39) Y38H probably benign Het
Pnpla8 A G 12: 44,329,963 (GRCm39) K172E probably benign Het
Pramel23 T C 4: 143,429,244 (GRCm39) Het
Prl8a9 T A 13: 27,744,511 (GRCm39) D110V probably benign Het
Prrx1 T C 1: 163,081,533 (GRCm39) probably null Het
Prss52 T A 14: 64,347,037 (GRCm39) H70Q probably benign Het
Rcc1 T C 4: 132,061,874 (GRCm39) T300A probably benign Het
Rnf114 T C 2: 167,349,014 (GRCm39) V64A possibly damaging Het
Rnf168 T C 16: 32,117,732 (GRCm39) I431T probably damaging Het
Rnmt A G 18: 68,444,726 (GRCm39) M232V probably benign Het
Rrs1 A C 1: 9,616,417 (GRCm39) Q223H probably benign Het
Scyl3 A T 1: 163,771,438 (GRCm39) L261F probably damaging Het
Slc24a4 A T 12: 102,230,707 (GRCm39) T533S probably benign Het
Slc26a2 A G 18: 61,331,430 (GRCm39) L667P probably damaging Het
Snrnp40 T A 4: 130,278,275 (GRCm39) V260D possibly damaging Het
Snrpa A C 7: 26,888,878 (GRCm39) M174R probably benign Het
Ss18l1 C T 2: 179,699,950 (GRCm39) A270V possibly damaging Het
Stk19 G T 17: 35,043,632 (GRCm39) Q193K probably benign Het
Syne1 T A 10: 5,374,382 (GRCm39) I142L probably damaging Het
Tbx2 T C 11: 85,731,727 (GRCm39) S675P probably benign Het
Tcaf1 A G 6: 42,652,289 (GRCm39) I731T probably damaging Het
Tg G T 15: 66,566,617 (GRCm39) G1222W probably damaging Het
Tsc2 A G 17: 24,816,922 (GRCm39) F1581L probably damaging Het
Ubr4 G C 4: 139,149,728 (GRCm39) V520L probably benign Het
Wls A T 3: 159,578,644 (GRCm39) N69Y probably benign Het
Wnk2 A G 13: 49,254,457 (GRCm39) F353L possibly damaging Het
Xkr6 G T 14: 64,056,610 (GRCm39) V430F probably benign Het
Zfp64 C T 2: 168,735,992 (GRCm39) G562R probably benign Het
Zfp663 T G 2: 165,194,728 (GRCm39) E497A probably damaging Het
Zfp995 A T 17: 22,099,333 (GRCm39) C300* probably null Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74,958,342 (GRCm39) critical splice donor site probably null
IGL01526:Cfap65 APN 1 74,950,237 (GRCm39) missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74,966,353 (GRCm39) missense probably benign
IGL01780:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL01993:Cfap65 APN 1 74,959,702 (GRCm39) missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74,967,304 (GRCm39) missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02357:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02576:Cfap65 APN 1 74,942,617 (GRCm39) missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74,944,239 (GRCm39) missense probably benign 0.00
IGL02792:Cfap65 APN 1 74,966,337 (GRCm39) missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74,950,267 (GRCm39) nonsense probably null
IGL03101:Cfap65 APN 1 74,967,592 (GRCm39) missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74,966,778 (GRCm39) missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74,943,801 (GRCm39) missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74,967,501 (GRCm39) missense probably benign 0.05
R0077:Cfap65 UTSW 1 74,971,077 (GRCm39) missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74,971,117 (GRCm39) nonsense probably null
R0281:Cfap65 UTSW 1 74,966,230 (GRCm39) missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74,943,226 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,461 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,460 (GRCm39) missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74,965,603 (GRCm39) missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74,959,760 (GRCm39) missense probably benign 0.00
R0361:Cfap65 UTSW 1 74,964,599 (GRCm39) missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74,956,043 (GRCm39) missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74,957,603 (GRCm39) missense probably benign 0.01
R0646:Cfap65 UTSW 1 74,941,328 (GRCm39) missense probably benign 0.09
R0734:Cfap65 UTSW 1 74,958,046 (GRCm39) missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74,943,841 (GRCm39) missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74,960,678 (GRCm39) missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74,944,872 (GRCm39) missense probably damaging 0.99
R1079:Cfap65 UTSW 1 74,941,606 (GRCm39) missense probably damaging 0.98
R1083:Cfap65 UTSW 1 74,957,663 (GRCm39) splice site probably benign
R1159:Cfap65 UTSW 1 74,968,499 (GRCm39) missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74,964,263 (GRCm39) missense probably benign 0.03
R1644:Cfap65 UTSW 1 74,956,334 (GRCm39) missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74,958,107 (GRCm39) missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74,946,819 (GRCm39) missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74,956,358 (GRCm39) missense probably benign 0.30
R2132:Cfap65 UTSW 1 74,946,850 (GRCm39) missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74,956,432 (GRCm39) frame shift probably null
R2219:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74,965,634 (GRCm39) missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74,966,345 (GRCm39) small insertion probably benign
R3114:Cfap65 UTSW 1 74,966,291 (GRCm39) missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74,959,701 (GRCm39) missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74,966,840 (GRCm39) missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74,942,517 (GRCm39) missense probably benign 0.17
R4547:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74,943,215 (GRCm39) missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74,964,513 (GRCm39) intron probably benign
R4701:Cfap65 UTSW 1 74,958,067 (GRCm39) missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74,967,520 (GRCm39) missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74,966,791 (GRCm39) missense probably benign 0.06
R4831:Cfap65 UTSW 1 74,956,454 (GRCm39) missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74,964,716 (GRCm39) missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74,958,420 (GRCm39) missense probably benign 0.00
R4881:Cfap65 UTSW 1 74,946,772 (GRCm39) missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74,942,283 (GRCm39) missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74,945,495 (GRCm39) nonsense probably null
R5074:Cfap65 UTSW 1 74,962,137 (GRCm39) missense probably benign 0.04
R5083:Cfap65 UTSW 1 74,945,600 (GRCm39) missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74,965,675 (GRCm39) missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74,964,061 (GRCm39) missense probably benign 0.07
R5333:Cfap65 UTSW 1 74,942,334 (GRCm39) missense probably benign 0.03
R5417:Cfap65 UTSW 1 74,964,259 (GRCm39) missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74,946,677 (GRCm39) intron probably benign
R5669:Cfap65 UTSW 1 74,964,127 (GRCm39) missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74,962,190 (GRCm39) missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74,959,564 (GRCm39) missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74,942,298 (GRCm39) missense probably benign 0.14
R6425:Cfap65 UTSW 1 74,966,868 (GRCm39) missense probably benign 0.00
R6677:Cfap65 UTSW 1 74,943,844 (GRCm39) missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74,956,445 (GRCm39) missense probably benign 0.00
R6838:Cfap65 UTSW 1 74,971,180 (GRCm39) missense probably benign 0.06
R6861:Cfap65 UTSW 1 74,964,274 (GRCm39) missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74,971,058 (GRCm39) missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74,965,792 (GRCm39) missense probably benign 0.01
R7320:Cfap65 UTSW 1 74,965,763 (GRCm39) missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74,960,742 (GRCm39) missense probably benign 0.07
R7426:Cfap65 UTSW 1 74,959,585 (GRCm39) missense possibly damaging 0.92
R7634:Cfap65 UTSW 1 74,941,593 (GRCm39) missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74,972,303 (GRCm39) missense probably benign 0.44
R7704:Cfap65 UTSW 1 74,967,527 (GRCm39) missense probably benign 0.19
R7727:Cfap65 UTSW 1 74,965,784 (GRCm39) missense probably benign 0.00
R7895:Cfap65 UTSW 1 74,972,321 (GRCm39) missense probably benign 0.05
R8215:Cfap65 UTSW 1 74,949,902 (GRCm39) missense probably damaging 1.00
R8344:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8345:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8413:Cfap65 UTSW 1 74,956,328 (GRCm39) nonsense probably null
R8431:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8432:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8528:Cfap65 UTSW 1 74,945,096 (GRCm39) missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74,942,382 (GRCm39) missense probably benign 0.43
R8996:Cfap65 UTSW 1 74,941,347 (GRCm39) missense probably benign 0.11
R9020:Cfap65 UTSW 1 74,959,552 (GRCm39) missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74,943,847 (GRCm39) missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74,958,510 (GRCm39) splice site probably benign
R9187:Cfap65 UTSW 1 74,956,517 (GRCm39) missense probably benign 0.00
R9210:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9212:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9273:Cfap65 UTSW 1 74,960,769 (GRCm39) missense probably benign 0.00
R9454:Cfap65 UTSW 1 74,944,210 (GRCm39) missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74,945,468 (GRCm39) critical splice donor site probably null
R9595:Cfap65 UTSW 1 74,946,537 (GRCm39) missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74,958,501 (GRCm39) missense probably benign 0.16
R9742:Cfap65 UTSW 1 74,943,840 (GRCm39) missense probably benign 0.08
RF009:Cfap65 UTSW 1 74,944,806 (GRCm39) missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74,949,906 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGATGGATGAGACAAGCCACC -3'
(R):5'- GGAACTGAGTTTTGCAGGGC -3'

Sequencing Primer
(F):5'- CCCTCCGGAAACTGATGATAGG -3'
(R):5'- CAAGCGGTGGGACTTCCTATGAG -3'
Posted On 2019-10-17