Incidental Mutation 'R7529:B3galt2'
ID583164
Institutional Source Beutler Lab
Gene Symbol B3galt2
Ensembl Gene ENSMUSG00000033849
Gene NameUDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R7529 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location143640664-143654614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 143646536 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 137 (K137Q)
Ref Sequence ENSEMBL: ENSMUSP00000046118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018337] [ENSMUST00000038252]
Predicted Effect probably benign
Transcript: ENSMUST00000018337
SMART Domains Protein: ENSMUSP00000018337
Gene: ENSMUSG00000026361

DomainStartEndE-ValueType
Pfam:CDC73_N 1 297 3.4e-135 PFAM
Pfam:CDC73_C 356 521 2.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038252
AA Change: K137Q

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000046118
Gene: ENSMUSG00000033849
AA Change: K137Q

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Galactosyl_T 165 359 3.8e-67 PFAM
Meta Mutation Damage Score 0.1042 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). This gene encodes a protein that functions in N-linked glycoprotein glycosylation and shows strict donor substrate specificity for UDP-galactose. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice for a targeted mutation display hyperactivity, impaired motor coordination, decreased anxiety, increased startle reflexes, and decreased coping response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T A 7: 128,237,164 K86* probably null Het
Ablim3 A C 18: 61,821,968 S317A probably benign Het
Adcy1 T C 11: 7,139,157 S524P probably damaging Het
Agps C A 2: 75,832,352 A47E possibly damaging Het
Arhgef15 G T 11: 68,954,022 R250S probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atoh8 G T 6: 72,223,841 D288E probably benign Het
Cacna2d4 G A 6: 119,270,766 V343I probably benign Het
Cage1 T C 13: 38,025,755 N82S possibly damaging Het
Cep350 A G 1: 155,861,923 S2725P probably benign Het
Cfap65 T C 1: 74,926,610 N414D probably damaging Het
Cgnl1 A C 9: 71,631,758 L1154R probably damaging Het
Cmya5 A T 13: 93,097,434 M382K probably benign Het
Dchs2 G A 3: 83,354,398 V2658M possibly damaging Het
Dlgap5 T C 14: 47,416,419 N51S probably damaging Het
Dnah17 A G 11: 118,049,866 probably null Het
Dnal1 A G 12: 84,131,343 I35V probably benign Het
Dtnbp1 A G 13: 44,931,070 F198S probably damaging Het
Edar A T 10: 58,612,008 S160T probably benign Het
Enpp3 A T 10: 24,798,174 N409K probably damaging Het
Ercc6 T A 14: 32,560,729 C726* probably null Het
Extl2 G A 3: 116,027,406 V301I possibly damaging Het
G2e3 A G 12: 51,371,604 Q594R probably damaging Het
Gal3st2c A G 1: 94,009,317 N328S probably benign Het
Galnt17 A G 5: 131,306,380 V74A probably damaging Het
Ggta1 A G 2: 35,414,244 W76R probably damaging Het
Gm13089 T C 4: 143,702,674 Het
Gm9573 A T 17: 35,619,231 S1354R unknown Het
Gm9772 T A 17: 22,007,159 D48V probably benign Het
Herpud2 T C 9: 25,108,897 T388A probably damaging Het
Ighv5-9-1 A G 12: 113,736,334 S53P possibly damaging Het
Il23r T A 6: 67,490,736 M16L possibly damaging Het
Ints1 G A 5: 139,767,726 A717V possibly damaging Het
Itpr2 A T 6: 146,194,598 L2122Q probably damaging Het
Klrg2 A T 6: 38,630,331 V248E probably damaging Het
Krtap5-5 A G 7: 142,229,692 C74R unknown Het
Luzp1 G T 4: 136,540,932 L155F probably damaging Het
Mcam T C 9: 44,138,895 V209A probably benign Het
Med1 G C 11: 98,155,965 T1335R unknown Het
Mroh2b A G 15: 4,949,009 I1346V probably damaging Het
Mrpl4 C G 9: 21,007,679 Q201E probably benign Het
Mylk2 T C 2: 152,915,704 L326P probably damaging Het
Myot A T 18: 44,346,173 R326* probably null Het
Nox3 T A 17: 3,671,775 R288S probably damaging Het
Nox4 A T 7: 87,395,768 Y572F unknown Het
Olfr1396 A G 11: 49,112,859 L289P probably damaging Het
Olfr1436 A G 19: 12,298,722 S137P probably damaging Het
Pcdhb15 G T 18: 37,474,473 E253* probably null Het
Plcb2 T C 2: 118,710,234 H1052R probably damaging Het
Plpp5 A T 8: 25,724,206 Q250L probably benign Het
Plxna2 T C 1: 194,643,871 Y38H probably benign Het
Pnpla8 A G 12: 44,283,180 K172E probably benign Het
Prl8a9 T A 13: 27,560,528 D110V probably benign Het
Prrx1 T C 1: 163,253,964 probably null Het
Prss52 T A 14: 64,109,588 H70Q probably benign Het
Rcc1 T C 4: 132,334,563 T300A probably benign Het
Rnf114 T C 2: 167,507,094 V64A possibly damaging Het
Rnf168 T C 16: 32,298,914 I431T probably damaging Het
Rnmt A G 18: 68,311,655 M232V probably benign Het
Rrs1 A C 1: 9,546,192 Q223H probably benign Het
Scyl3 A T 1: 163,943,869 L261F probably damaging Het
Slc24a4 A T 12: 102,264,448 T533S probably benign Het
Slc26a2 A G 18: 61,198,358 L667P probably damaging Het
Snrnp40 T A 4: 130,384,482 V260D possibly damaging Het
Snrpa A C 7: 27,189,453 M174R probably benign Het
Ss18l1 C T 2: 180,058,157 A270V possibly damaging Het
Stk19 G T 17: 34,824,656 Q193K probably benign Het
Syne1 T A 10: 5,424,382 I142L probably damaging Het
Tbx2 T C 11: 85,840,901 S675P probably benign Het
Tcaf1 A G 6: 42,675,355 I731T probably damaging Het
Tg G T 15: 66,694,768 G1222W probably damaging Het
Tsc2 A G 17: 24,597,948 F1581L probably damaging Het
Ubr4 G C 4: 139,422,417 V520L probably benign Het
Wls A T 3: 159,873,007 N69Y probably benign Het
Wnk2 A G 13: 49,100,981 F353L possibly damaging Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp64 C T 2: 168,894,072 G562R probably benign Het
Zfp663 T G 2: 165,352,808 E497A probably damaging Het
Zfp995 A T 17: 21,880,352 C300* probably null Het
Other mutations in B3galt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:B3galt2 APN 1 143647155 missense probably damaging 1.00
IGL01019:B3galt2 APN 1 143646757 missense probably benign 0.00
IGL01406:B3galt2 APN 1 143647106 missense possibly damaging 0.91
IGL01736:B3galt2 APN 1 143646845 missense probably benign 0.00
IGL02427:B3galt2 APN 1 143646516 missense probably benign
IGL03289:B3galt2 APN 1 143647304 missense probably damaging 1.00
R0143:B3galt2 UTSW 1 143647334 missense possibly damaging 0.95
R0620:B3galt2 UTSW 1 143646140 missense probably damaging 1.00
R0665:B3galt2 UTSW 1 143646453 missense possibly damaging 0.64
R1765:B3galt2 UTSW 1 143646469 missense probably benign 0.03
R2325:B3galt2 UTSW 1 143647188 missense probably benign 0.01
R3817:B3galt2 UTSW 1 143647073 missense probably damaging 1.00
R5248:B3galt2 UTSW 1 143647111 missense probably benign 0.01
R5863:B3galt2 UTSW 1 143646366 missense probably benign 0.36
R6339:B3galt2 UTSW 1 143646902 missense possibly damaging 0.49
R6419:B3galt2 UTSW 1 143647101 missense possibly damaging 0.48
R7577:B3galt2 UTSW 1 143647304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATCTGGAAAGAAGTAGCTC -3'
(R):5'- TTGCAACCCAGTTCATACCC -3'

Sequencing Primer
(F):5'- AGAAGTAGCTCCTCAGACTCTG -3'
(R):5'- GCATGTTGAAGATAGCCATTTAGC -3'
Posted On2019-10-17