Incidental Mutation 'R7529:Plxna2'
ID583167
Institutional Source Beutler Lab
Gene Symbol Plxna2
Ensembl Gene ENSMUSG00000026640
Gene Nameplexin A2
Synonyms2810428A13Rik, OCT, PlexA2, Plxn2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7529 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location194618218-194816869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 194643871 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 38 (Y38H)
Ref Sequence ENSEMBL: ENSMUSP00000027952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027952]
PDB Structure
Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027952
AA Change: Y38H

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: Y38H

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
Sema 50 492 1.65e-132 SMART
PSI 510 560 8e-12 SMART
PSI 655 702 6.35e-6 SMART
PSI 803 856 1.24e-8 SMART
IPT 857 952 6.36e-21 SMART
IPT 953 1038 1.02e-24 SMART
IPT 1040 1140 1.48e-21 SMART
IPT 1142 1237 8.81e-6 SMART
transmembrane domain 1238 1260 N/A INTRINSIC
Pfam:Plexin_cytopl 1311 1864 1.9e-261 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T A 7: 128,237,164 K86* probably null Het
Ablim3 A C 18: 61,821,968 S317A probably benign Het
Adcy1 T C 11: 7,139,157 S524P probably damaging Het
Agps C A 2: 75,832,352 A47E possibly damaging Het
Arhgef15 G T 11: 68,954,022 R250S probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atoh8 G T 6: 72,223,841 D288E probably benign Het
B3galt2 A C 1: 143,646,536 K137Q probably benign Het
Cacna2d4 G A 6: 119,270,766 V343I probably benign Het
Cage1 T C 13: 38,025,755 N82S possibly damaging Het
Cep350 A G 1: 155,861,923 S2725P probably benign Het
Cfap65 T C 1: 74,926,610 N414D probably damaging Het
Cgnl1 A C 9: 71,631,758 L1154R probably damaging Het
Cmya5 A T 13: 93,097,434 M382K probably benign Het
Dchs2 G A 3: 83,354,398 V2658M possibly damaging Het
Dlgap5 T C 14: 47,416,419 N51S probably damaging Het
Dnah17 A G 11: 118,049,866 probably null Het
Dnal1 A G 12: 84,131,343 I35V probably benign Het
Dtnbp1 A G 13: 44,931,070 F198S probably damaging Het
Edar A T 10: 58,612,008 S160T probably benign Het
Enpp3 A T 10: 24,798,174 N409K probably damaging Het
Ercc6 T A 14: 32,560,729 C726* probably null Het
Extl2 G A 3: 116,027,406 V301I possibly damaging Het
G2e3 A G 12: 51,371,604 Q594R probably damaging Het
Gal3st2c A G 1: 94,009,317 N328S probably benign Het
Galnt17 A G 5: 131,306,380 V74A probably damaging Het
Ggta1 A G 2: 35,414,244 W76R probably damaging Het
Gm13089 T C 4: 143,702,674 Het
Gm9573 A T 17: 35,619,231 S1354R unknown Het
Gm9772 T A 17: 22,007,159 D48V probably benign Het
Herpud2 T C 9: 25,108,897 T388A probably damaging Het
Ighv5-9-1 A G 12: 113,736,334 S53P possibly damaging Het
Il23r T A 6: 67,490,736 M16L possibly damaging Het
Ints1 G A 5: 139,767,726 A717V possibly damaging Het
Itpr2 A T 6: 146,194,598 L2122Q probably damaging Het
Klrg2 A T 6: 38,630,331 V248E probably damaging Het
Krtap5-5 A G 7: 142,229,692 C74R unknown Het
Luzp1 G T 4: 136,540,932 L155F probably damaging Het
Mcam T C 9: 44,138,895 V209A probably benign Het
Med1 G C 11: 98,155,965 T1335R unknown Het
Mroh2b A G 15: 4,949,009 I1346V probably damaging Het
Mrpl4 C G 9: 21,007,679 Q201E probably benign Het
Mylk2 T C 2: 152,915,704 L326P probably damaging Het
Myot A T 18: 44,346,173 R326* probably null Het
Nox3 T A 17: 3,671,775 R288S probably damaging Het
Nox4 A T 7: 87,395,768 Y572F unknown Het
Olfr1396 A G 11: 49,112,859 L289P probably damaging Het
Olfr1436 A G 19: 12,298,722 S137P probably damaging Het
Pcdhb15 G T 18: 37,474,473 E253* probably null Het
Plcb2 T C 2: 118,710,234 H1052R probably damaging Het
Plpp5 A T 8: 25,724,206 Q250L probably benign Het
Pnpla8 A G 12: 44,283,180 K172E probably benign Het
Prl8a9 T A 13: 27,560,528 D110V probably benign Het
Prss52 T A 14: 64,109,588 H70Q probably benign Het
Rcc1 T C 4: 132,334,563 T300A probably benign Het
Rnf114 T C 2: 167,507,094 V64A possibly damaging Het
Rnf168 T C 16: 32,298,914 I431T probably damaging Het
Rnmt A G 18: 68,311,655 M232V probably benign Het
Rrs1 A C 1: 9,546,192 Q223H probably benign Het
Scyl3 A T 1: 163,943,869 L261F probably damaging Het
Slc24a4 A T 12: 102,264,448 T533S probably benign Het
Slc26a2 A G 18: 61,198,358 L667P probably damaging Het
Snrnp40 T A 4: 130,384,482 V260D possibly damaging Het
Snrpa A C 7: 27,189,453 M174R probably benign Het
Ss18l1 C T 2: 180,058,157 A270V possibly damaging Het
Stk19 G T 17: 34,824,656 Q193K probably benign Het
Syne1 T A 10: 5,424,382 I142L probably damaging Het
Tbx2 T C 11: 85,840,901 S675P probably benign Het
Tcaf1 A G 6: 42,675,355 I731T probably damaging Het
Tg G T 15: 66,694,768 G1222W probably damaging Het
Tsc2 A G 17: 24,597,948 F1581L probably damaging Het
Ubr4 G C 4: 139,422,417 V520L probably benign Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Wls A T 3: 159,873,007 N69Y probably benign Het
Wnk2 A G 13: 49,100,981 F353L possibly damaging Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp64 C T 2: 168,894,072 G562R probably benign Het
Zfp663 T G 2: 165,352,808 E497A probably damaging Het
Zfp995 A T 17: 21,880,352 C300* probably null Het
Other mutations in Plxna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Plxna2 APN 1 194644657 missense probably damaging 1.00
IGL00332:Plxna2 APN 1 194789830 missense probably damaging 0.98
IGL00392:Plxna2 APN 1 194800568 missense probably damaging 1.00
IGL00432:Plxna2 APN 1 194644096 missense probably benign 0.03
IGL00704:Plxna2 APN 1 194751461 missense probably damaging 0.99
IGL00737:Plxna2 APN 1 194746239 splice site probably benign
IGL01078:Plxna2 APN 1 194786693 unclassified probably benign
IGL01354:Plxna2 APN 1 194762435 missense probably benign 0.02
IGL01432:Plxna2 APN 1 194644318 missense possibly damaging 0.58
IGL01459:Plxna2 APN 1 194764570 missense probably benign 0.00
IGL01525:Plxna2 APN 1 194712311 missense probably benign 0.00
IGL01656:Plxna2 APN 1 194790161 missense possibly damaging 0.52
IGL01825:Plxna2 APN 1 194788902 missense probably damaging 0.98
IGL01862:Plxna2 APN 1 194643950 missense possibly damaging 0.87
IGL01899:Plxna2 APN 1 194751488 missense probably damaging 1.00
IGL01996:Plxna2 APN 1 194799776 missense probably damaging 0.99
IGL02123:Plxna2 APN 1 194794383 missense probably damaging 1.00
IGL02226:Plxna2 APN 1 194644424 missense probably damaging 1.00
IGL02227:Plxna2 APN 1 194752089 missense probably damaging 1.00
IGL02415:Plxna2 APN 1 194643964 missense probably damaging 1.00
IGL02440:Plxna2 APN 1 194746150 missense probably benign 0.10
IGL02545:Plxna2 APN 1 194786690 unclassified probably benign
IGL02553:Plxna2 APN 1 194751438 missense probably benign 0.08
IGL02882:Plxna2 APN 1 194762570 missense probably damaging 1.00
IGL02946:Plxna2 APN 1 194749309 splice site probably benign
IGL03062:Plxna2 APN 1 194762550 missense possibly damaging 0.72
IGL03095:Plxna2 APN 1 194801127 missense probably damaging 1.00
IGL03293:Plxna2 APN 1 194804945 missense probably damaging 0.99
PIT4514001:Plxna2 UTSW 1 194794937 missense probably benign 0.00
R0024:Plxna2 UTSW 1 194643995 missense possibly damaging 0.57
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0217:Plxna2 UTSW 1 194644598 missense probably damaging 1.00
R0316:Plxna2 UTSW 1 194644150 missense probably damaging 1.00
R0440:Plxna2 UTSW 1 194644404 nonsense probably null
R0505:Plxna2 UTSW 1 194644348 missense possibly damaging 0.93
R0568:Plxna2 UTSW 1 194751386 missense probably benign 0.00
R0669:Plxna2 UTSW 1 194788837 missense probably damaging 0.99
R0674:Plxna2 UTSW 1 194649475 missense probably benign 0.00
R0885:Plxna2 UTSW 1 194644556 missense probably benign
R0898:Plxna2 UTSW 1 194797024 missense probably damaging 1.00
R0940:Plxna2 UTSW 1 194800555 missense probably benign 0.01
R1061:Plxna2 UTSW 1 194644093 missense probably damaging 1.00
R1067:Plxna2 UTSW 1 194780510 splice site probably null
R1222:Plxna2 UTSW 1 194800649 missense probably damaging 1.00
R1345:Plxna2 UTSW 1 194644486 missense probably damaging 1.00
R1363:Plxna2 UTSW 1 194804939 nonsense probably null
R1432:Plxna2 UTSW 1 194767463 missense probably benign 0.10
R1434:Plxna2 UTSW 1 194751540 splice site probably benign
R1597:Plxna2 UTSW 1 194749306 splice site probably benign
R1719:Plxna2 UTSW 1 194644370 missense possibly damaging 0.93
R1778:Plxna2 UTSW 1 194810970 missense probably benign 0.01
R1795:Plxna2 UTSW 1 194806303 missense probably damaging 0.99
R1819:Plxna2 UTSW 1 194790186 missense probably benign 0.03
R1926:Plxna2 UTSW 1 194762450 missense probably benign 0.02
R1966:Plxna2 UTSW 1 194644700 missense possibly damaging 0.91
R1987:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R1988:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R2034:Plxna2 UTSW 1 194780594 missense probably benign 0.00
R2131:Plxna2 UTSW 1 194644750 missense probably benign 0.01
R2171:Plxna2 UTSW 1 194800617 missense probably damaging 1.00
R2217:Plxna2 UTSW 1 194797748 missense probably damaging 1.00
R2311:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2340:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2342:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2423:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2424:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2425:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2842:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2971:Plxna2 UTSW 1 194797731 missense probably damaging 1.00
R3236:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3731:Plxna2 UTSW 1 194788885 missense probably benign 0.42
R3783:Plxna2 UTSW 1 194807521 missense probably damaging 1.00
R3784:Plxna2 UTSW 1 194644617 missense probably benign
R3787:Plxna2 UTSW 1 194643934 missense probably benign 0.10
R3845:Plxna2 UTSW 1 194793790 missense probably damaging 0.96
R3927:Plxna2 UTSW 1 194746157 missense probably benign 0.02
R3930:Plxna2 UTSW 1 194794910 missense probably benign 0.17
R3964:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3980:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4067:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4120:Plxna2 UTSW 1 194780627 missense probably damaging 1.00
R4231:Plxna2 UTSW 1 194644454 missense probably damaging 1.00
R4257:Plxna2 UTSW 1 194644775 missense probably damaging 1.00
R4396:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4397:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4418:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4444:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4446:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4482:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4487:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4489:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4571:Plxna2 UTSW 1 194810988 missense possibly damaging 0.91
R4622:Plxna2 UTSW 1 194812150 missense probably benign
R4623:Plxna2 UTSW 1 194812150 missense probably benign
R4684:Plxna2 UTSW 1 194762594 missense probably benign 0.42
R4688:Plxna2 UTSW 1 194644445 missense probably damaging 1.00
R4855:Plxna2 UTSW 1 194797732 missense probably benign 0.39
R4876:Plxna2 UTSW 1 194643775 missense probably benign 0.02
R5161:Plxna2 UTSW 1 194751404 missense probably benign
R5207:Plxna2 UTSW 1 194788899 missense probably benign 0.19
R5479:Plxna2 UTSW 1 194793873 missense probably benign
R5931:Plxna2 UTSW 1 194810870 missense probably damaging 1.00
R6026:Plxna2 UTSW 1 194799814 missense probably damaging 1.00
R6029:Plxna2 UTSW 1 194794427 missense probably benign 0.00
R6029:Plxna2 UTSW 1 194799575 missense probably damaging 1.00
R6059:Plxna2 UTSW 1 194810971 missense possibly damaging 0.79
R6238:Plxna2 UTSW 1 194790196 missense probably benign 0.01
R6322:Plxna2 UTSW 1 194754367 missense possibly damaging 0.89
R6668:Plxna2 UTSW 1 194810088 missense possibly damaging 0.68
R6709:Plxna2 UTSW 1 194789766 missense probably benign 0.01
R6748:Plxna2 UTSW 1 194794182 intron probably null
R6838:Plxna2 UTSW 1 194804914 missense possibly damaging 0.90
R6844:Plxna2 UTSW 1 194793828 missense probably benign 0.08
R7069:Plxna2 UTSW 1 194793904 missense possibly damaging 0.51
R7122:Plxna2 UTSW 1 194644568 nonsense probably null
R7145:Plxna2 UTSW 1 194649522 missense probably benign 0.31
R7189:Plxna2 UTSW 1 194801058 missense possibly damaging 0.58
R7207:Plxna2 UTSW 1 194644019 missense probably damaging 1.00
R7232:Plxna2 UTSW 1 194712260 missense probably damaging 1.00
R7234:Plxna2 UTSW 1 194806390 missense probably damaging 0.96
R7246:Plxna2 UTSW 1 194644282 missense possibly damaging 0.74
R7255:Plxna2 UTSW 1 194752103 missense probably benign 0.03
R7283:Plxna2 UTSW 1 194644883 missense probably damaging 0.99
R7288:Plxna2 UTSW 1 194796919 missense probably damaging 1.00
R7361:Plxna2 UTSW 1 194799779 missense probably damaging 1.00
R7424:Plxna2 UTSW 1 194806339 missense probably damaging 0.98
R7501:Plxna2 UTSW 1 194643895 missense possibly damaging 0.95
R7528:Plxna2 UTSW 1 194812156 missense probably damaging 1.00
R7532:Plxna2 UTSW 1 194644819 missense probably benign 0.13
X0027:Plxna2 UTSW 1 194644433 missense probably damaging 1.00
Z1088:Plxna2 UTSW 1 194644441 missense possibly damaging 0.56
Z1088:Plxna2 UTSW 1 194764539 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GAACCATGTGAGAGCTGATCTTG -3'
(R):5'- GTGTAAGCACTTCACTGCAGG -3'

Sequencing Primer
(F):5'- CCATGTGAGAGCTGATCTTGAAAAG -3'
(R):5'- CTTCACTGCAGGGCTGTACAATG -3'
Posted On2019-10-17