Incidental Mutation 'R7529:Rcc1'
ID583181
Institutional Source Beutler Lab
Gene Symbol Rcc1
Ensembl Gene ENSMUSG00000028896
Gene Nameregulator of chromosome condensation 1
SynonymsChc1, 4931417M11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R7529 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location132331919-132353605 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132334563 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 300 (T300A)
Ref Sequence ENSEMBL: ENSMUSP00000030726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030726] [ENSMUST00000084250] [ENSMUST00000105951] [ENSMUST00000155129]
Predicted Effect probably benign
Transcript: ENSMUST00000030726
AA Change: T300A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030726
Gene: ENSMUSG00000028896
AA Change: T300A

DomainStartEndE-ValueType
Pfam:RCC1 47 95 7.9e-12 PFAM
Pfam:RCC1 98 147 7.5e-17 PFAM
Pfam:RCC1_2 134 165 1.3e-11 PFAM
Pfam:RCC1 150 200 9.9e-10 PFAM
Pfam:RCC1_2 187 216 3.2e-7 PFAM
Pfam:RCC1 203 268 4.2e-14 PFAM
Pfam:RCC1 271 322 1.1e-11 PFAM
Pfam:RCC1 325 373 3.4e-10 PFAM
Pfam:RCC1 376 427 3.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084250
AA Change: T287A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000081271
Gene: ENSMUSG00000028896
AA Change: T287A

DomainStartEndE-ValueType
low complexity region 19 26 N/A INTRINSIC
Pfam:RCC1 34 82 4.1e-10 PFAM
Pfam:RCC1 85 134 1.4e-13 PFAM
Pfam:RCC1_2 121 151 1.5e-8 PFAM
Pfam:RCC1 137 187 1.7e-7 PFAM
Pfam:RCC1_2 174 203 3e-5 PFAM
Pfam:RCC1 190 255 9.6e-11 PFAM
Pfam:RCC1 258 309 1.9e-9 PFAM
Pfam:RCC1 312 360 5.7e-9 PFAM
Pfam:RCC1 363 414 3.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105951
AA Change: T287A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101571
Gene: ENSMUSG00000028896
AA Change: T287A

DomainStartEndE-ValueType
low complexity region 19 26 N/A INTRINSIC
Pfam:RCC1 34 82 4.1e-10 PFAM
Pfam:RCC1 85 134 1.4e-13 PFAM
Pfam:RCC1_2 121 151 1.5e-8 PFAM
Pfam:RCC1 137 187 1.7e-7 PFAM
Pfam:RCC1_2 174 203 3e-5 PFAM
Pfam:RCC1 190 255 9.6e-11 PFAM
Pfam:RCC1 258 309 1.9e-9 PFAM
Pfam:RCC1 312 360 5.7e-9 PFAM
Pfam:RCC1 363 414 3.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155129
SMART Domains Protein: ENSMUSP00000120701
Gene: ENSMUSG00000028896

DomainStartEndE-ValueType
low complexity region 19 26 N/A INTRINSIC
Pfam:RCC1 34 82 3.9e-13 PFAM
Pfam:RCC1_2 69 98 5.2e-7 PFAM
Pfam:RCC1 85 116 5.3e-8 PFAM
Meta Mutation Damage Score 0.0994 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T A 7: 128,237,164 K86* probably null Het
Ablim3 A C 18: 61,821,968 S317A probably benign Het
Adcy1 T C 11: 7,139,157 S524P probably damaging Het
Agps C A 2: 75,832,352 A47E possibly damaging Het
Arhgef15 G T 11: 68,954,022 R250S probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atoh8 G T 6: 72,223,841 D288E probably benign Het
B3galt2 A C 1: 143,646,536 K137Q probably benign Het
Cacna2d4 G A 6: 119,270,766 V343I probably benign Het
Cage1 T C 13: 38,025,755 N82S possibly damaging Het
Cep350 A G 1: 155,861,923 S2725P probably benign Het
Cfap65 T C 1: 74,926,610 N414D probably damaging Het
Cgnl1 A C 9: 71,631,758 L1154R probably damaging Het
Cmya5 A T 13: 93,097,434 M382K probably benign Het
Dchs2 G A 3: 83,354,398 V2658M possibly damaging Het
Dlgap5 T C 14: 47,416,419 N51S probably damaging Het
Dnah17 A G 11: 118,049,866 probably null Het
Dnal1 A G 12: 84,131,343 I35V probably benign Het
Dtnbp1 A G 13: 44,931,070 F198S probably damaging Het
Edar A T 10: 58,612,008 S160T probably benign Het
Enpp3 A T 10: 24,798,174 N409K probably damaging Het
Ercc6 T A 14: 32,560,729 C726* probably null Het
Extl2 G A 3: 116,027,406 V301I possibly damaging Het
G2e3 A G 12: 51,371,604 Q594R probably damaging Het
Gal3st2c A G 1: 94,009,317 N328S probably benign Het
Galnt17 A G 5: 131,306,380 V74A probably damaging Het
Ggta1 A G 2: 35,414,244 W76R probably damaging Het
Gm13089 T C 4: 143,702,674 Het
Gm9573 A T 17: 35,619,231 S1354R unknown Het
Gm9772 T A 17: 22,007,159 D48V probably benign Het
Herpud2 T C 9: 25,108,897 T388A probably damaging Het
Ighv5-9-1 A G 12: 113,736,334 S53P possibly damaging Het
Il23r T A 6: 67,490,736 M16L possibly damaging Het
Ints1 G A 5: 139,767,726 A717V possibly damaging Het
Itpr2 A T 6: 146,194,598 L2122Q probably damaging Het
Klrg2 A T 6: 38,630,331 V248E probably damaging Het
Krtap5-5 A G 7: 142,229,692 C74R unknown Het
Luzp1 G T 4: 136,540,932 L155F probably damaging Het
Mcam T C 9: 44,138,895 V209A probably benign Het
Med1 G C 11: 98,155,965 T1335R unknown Het
Mroh2b A G 15: 4,949,009 I1346V probably damaging Het
Mrpl4 C G 9: 21,007,679 Q201E probably benign Het
Mylk2 T C 2: 152,915,704 L326P probably damaging Het
Myot A T 18: 44,346,173 R326* probably null Het
Nox3 T A 17: 3,671,775 R288S probably damaging Het
Nox4 A T 7: 87,395,768 Y572F unknown Het
Olfr1396 A G 11: 49,112,859 L289P probably damaging Het
Olfr1436 A G 19: 12,298,722 S137P probably damaging Het
Pcdhb15 G T 18: 37,474,473 E253* probably null Het
Plcb2 T C 2: 118,710,234 H1052R probably damaging Het
Plpp5 A T 8: 25,724,206 Q250L probably benign Het
Plxna2 T C 1: 194,643,871 Y38H probably benign Het
Pnpla8 A G 12: 44,283,180 K172E probably benign Het
Prl8a9 T A 13: 27,560,528 D110V probably benign Het
Prrx1 T C 1: 163,253,964 probably null Het
Prss52 T A 14: 64,109,588 H70Q probably benign Het
Rnf114 T C 2: 167,507,094 V64A possibly damaging Het
Rnf168 T C 16: 32,298,914 I431T probably damaging Het
Rnmt A G 18: 68,311,655 M232V probably benign Het
Rrs1 A C 1: 9,546,192 Q223H probably benign Het
Scyl3 A T 1: 163,943,869 L261F probably damaging Het
Slc24a4 A T 12: 102,264,448 T533S probably benign Het
Slc26a2 A G 18: 61,198,358 L667P probably damaging Het
Snrnp40 T A 4: 130,384,482 V260D possibly damaging Het
Snrpa A C 7: 27,189,453 M174R probably benign Het
Ss18l1 C T 2: 180,058,157 A270V possibly damaging Het
Stk19 G T 17: 34,824,656 Q193K probably benign Het
Syne1 T A 10: 5,424,382 I142L probably damaging Het
Tbx2 T C 11: 85,840,901 S675P probably benign Het
Tcaf1 A G 6: 42,675,355 I731T probably damaging Het
Tg G T 15: 66,694,768 G1222W probably damaging Het
Tsc2 A G 17: 24,597,948 F1581L probably damaging Het
Ubr4 G C 4: 139,422,417 V520L probably benign Het
Wls A T 3: 159,873,007 N69Y probably benign Het
Wnk2 A G 13: 49,100,981 F353L possibly damaging Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp64 C T 2: 168,894,072 G562R probably benign Het
Zfp663 T G 2: 165,352,808 E497A probably damaging Het
Zfp995 A T 17: 21,880,352 C300* probably null Het
Other mutations in Rcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02881:Rcc1 APN 4 132337756 missense probably benign 0.20
IGL02927:Rcc1 APN 4 132337756 missense probably benign 0.20
IGL02802:Rcc1 UTSW 4 132337756 missense probably benign 0.20
IGL02837:Rcc1 UTSW 4 132337756 missense probably benign 0.20
R0240:Rcc1 UTSW 4 132332915 missense probably damaging 1.00
R0240:Rcc1 UTSW 4 132332915 missense probably damaging 1.00
R0828:Rcc1 UTSW 4 132335825 unclassified probably benign
R1606:Rcc1 UTSW 4 132334776 unclassified probably null
R2155:Rcc1 UTSW 4 132338049 critical splice donor site probably null
R3721:Rcc1 UTSW 4 132337814 missense possibly damaging 0.46
R4633:Rcc1 UTSW 4 132335769 missense probably damaging 0.98
R4908:Rcc1 UTSW 4 132337753 missense probably damaging 1.00
R4936:Rcc1 UTSW 4 132335735 missense probably damaging 0.96
R5461:Rcc1 UTSW 4 132334186 missense probably benign 0.00
R5627:Rcc1 UTSW 4 132338143 missense probably damaging 0.98
R6088:Rcc1 UTSW 4 132332842 missense probably benign 0.00
R6197:Rcc1 UTSW 4 132337762 missense possibly damaging 0.58
R6456:Rcc1 UTSW 4 132334116 missense probably benign 0.10
R7127:Rcc1 UTSW 4 132334796 missense probably damaging 0.98
R7440:Rcc1 UTSW 4 132337799 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTTCATACTCGGAAGCACCACG -3'
(R):5'- TCCAACTATCACCAGCTCGG -3'

Sequencing Primer
(F):5'- AACCCTCATGGATGCAAATCTATGTC -3'
(R):5'- AGCTCGGTGAGTCCTCCTC -3'
Posted On2019-10-17