Incidental Mutation 'R7529:Nox4'
ID583195
Institutional Source Beutler Lab
Gene Symbol Nox4
Ensembl Gene ENSMUSG00000030562
Gene NameNADPH oxidase 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7529 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location87246096-87398710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87395768 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 572 (Y572F)
Ref Sequence ENSEMBL: ENSMUSP00000070039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032781] [ENSMUST00000068829] [ENSMUST00000126887] [ENSMUST00000136577] [ENSMUST00000144267]
Predicted Effect probably benign
Transcript: ENSMUST00000032781
SMART Domains Protein: ENSMUSP00000032781
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 58 205 8.3e-21 PFAM
Pfam:FAD_binding_8 306 417 2.8e-17 PFAM
Pfam:NAD_binding_6 423 561 7.3e-24 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000068829
AA Change: Y572F
SMART Domains Protein: ENSMUSP00000070039
Gene: ENSMUSG00000030562
AA Change: Y572F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 58 205 5.3e-27 PFAM
Pfam:FAD_binding_8 306 417 5.5e-17 PFAM
Pfam:NAD_binding_6 423 539 4.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126887
SMART Domains Protein: ENSMUSP00000138336
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136577
SMART Domains Protein: ENSMUSP00000138274
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144267
SMART Domains Protein: ENSMUSP00000138143
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a null allele display increased heart damage following pressure overload. Mice with a cardiomyocyte specific deletion show decreased damage following pressure overload. Mice homozygous for a different knock-out allele exhibit decreased suseptibility to bleomycin-induced fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T A 7: 128,237,164 K86* probably null Het
Ablim3 A C 18: 61,821,968 S317A probably benign Het
Adcy1 T C 11: 7,139,157 S524P probably damaging Het
Agps C A 2: 75,832,352 A47E possibly damaging Het
Arhgef15 G T 11: 68,954,022 R250S probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atoh8 G T 6: 72,223,841 D288E probably benign Het
B3galt2 A C 1: 143,646,536 K137Q probably benign Het
Cacna2d4 G A 6: 119,270,766 V343I probably benign Het
Cage1 T C 13: 38,025,755 N82S possibly damaging Het
Cep350 A G 1: 155,861,923 S2725P probably benign Het
Cfap65 T C 1: 74,926,610 N414D probably damaging Het
Cgnl1 A C 9: 71,631,758 L1154R probably damaging Het
Cmya5 A T 13: 93,097,434 M382K probably benign Het
Dchs2 G A 3: 83,354,398 V2658M possibly damaging Het
Dlgap5 T C 14: 47,416,419 N51S probably damaging Het
Dnah17 A G 11: 118,049,866 probably null Het
Dnal1 A G 12: 84,131,343 I35V probably benign Het
Dtnbp1 A G 13: 44,931,070 F198S probably damaging Het
Edar A T 10: 58,612,008 S160T probably benign Het
Enpp3 A T 10: 24,798,174 N409K probably damaging Het
Ercc6 T A 14: 32,560,729 C726* probably null Het
Extl2 G A 3: 116,027,406 V301I possibly damaging Het
G2e3 A G 12: 51,371,604 Q594R probably damaging Het
Gal3st2c A G 1: 94,009,317 N328S probably benign Het
Galnt17 A G 5: 131,306,380 V74A probably damaging Het
Ggta1 A G 2: 35,414,244 W76R probably damaging Het
Gm13089 T C 4: 143,702,674 Het
Gm9573 A T 17: 35,619,231 S1354R unknown Het
Gm9772 T A 17: 22,007,159 D48V probably benign Het
Herpud2 T C 9: 25,108,897 T388A probably damaging Het
Ighv5-9-1 A G 12: 113,736,334 S53P possibly damaging Het
Il23r T A 6: 67,490,736 M16L possibly damaging Het
Ints1 G A 5: 139,767,726 A717V possibly damaging Het
Itpr2 A T 6: 146,194,598 L2122Q probably damaging Het
Klrg2 A T 6: 38,630,331 V248E probably damaging Het
Krtap5-5 A G 7: 142,229,692 C74R unknown Het
Luzp1 G T 4: 136,540,932 L155F probably damaging Het
Mcam T C 9: 44,138,895 V209A probably benign Het
Med1 G C 11: 98,155,965 T1335R unknown Het
Mroh2b A G 15: 4,949,009 I1346V probably damaging Het
Mrpl4 C G 9: 21,007,679 Q201E probably benign Het
Mylk2 T C 2: 152,915,704 L326P probably damaging Het
Myot A T 18: 44,346,173 R326* probably null Het
Nox3 T A 17: 3,671,775 R288S probably damaging Het
Olfr1396 A G 11: 49,112,859 L289P probably damaging Het
Olfr1436 A G 19: 12,298,722 S137P probably damaging Het
Pcdhb15 G T 18: 37,474,473 E253* probably null Het
Plcb2 T C 2: 118,710,234 H1052R probably damaging Het
Plpp5 A T 8: 25,724,206 Q250L probably benign Het
Plxna2 T C 1: 194,643,871 Y38H probably benign Het
Pnpla8 A G 12: 44,283,180 K172E probably benign Het
Prl8a9 T A 13: 27,560,528 D110V probably benign Het
Prss52 T A 14: 64,109,588 H70Q probably benign Het
Rcc1 T C 4: 132,334,563 T300A probably benign Het
Rnf114 T C 2: 167,507,094 V64A possibly damaging Het
Rnf168 T C 16: 32,298,914 I431T probably damaging Het
Rnmt A G 18: 68,311,655 M232V probably benign Het
Rrs1 A C 1: 9,546,192 Q223H probably benign Het
Scyl3 A T 1: 163,943,869 L261F probably damaging Het
Slc24a4 A T 12: 102,264,448 T533S probably benign Het
Slc26a2 A G 18: 61,198,358 L667P probably damaging Het
Snrnp40 T A 4: 130,384,482 V260D possibly damaging Het
Snrpa A C 7: 27,189,453 M174R probably benign Het
Ss18l1 C T 2: 180,058,157 A270V possibly damaging Het
Stk19 G T 17: 34,824,656 Q193K probably benign Het
Syne1 T A 10: 5,424,382 I142L probably damaging Het
Tbx2 T C 11: 85,840,901 S675P probably benign Het
Tcaf1 A G 6: 42,675,355 I731T probably damaging Het
Tg G T 15: 66,694,768 G1222W probably damaging Het
Tsc2 A G 17: 24,597,948 F1581L probably damaging Het
Ubr4 G C 4: 139,422,417 V520L probably benign Het
Vmn2r60 AG A 7: 42,195,734 probably null Het
Wls A T 3: 159,873,007 N69Y probably benign Het
Wnk2 A G 13: 49,100,981 F353L possibly damaging Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp64 C T 2: 168,894,072 G562R probably benign Het
Zfp663 T G 2: 165,352,808 E497A probably damaging Het
Zfp995 A T 17: 21,880,352 C300* probably null Het
Other mutations in Nox4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Nox4 APN 7 87376216 missense possibly damaging 0.89
IGL02711:Nox4 APN 7 87396868 missense probably damaging 1.00
IGL03234:Nox4 APN 7 87317313 critical splice donor site probably null
IGL03286:Nox4 APN 7 87370141 splice site probably benign
LCD18:Nox4 UTSW 7 87243067 unclassified probably benign
PIT4151001:Nox4 UTSW 7 87304889 missense probably benign 0.02
R0717:Nox4 UTSW 7 87304890 nonsense probably null
R1033:Nox4 UTSW 7 87374413 missense probably damaging 0.99
R1135:Nox4 UTSW 7 87323789 missense probably damaging 1.00
R1333:Nox4 UTSW 7 87246864 missense possibly damaging 0.80
R1477:Nox4 UTSW 7 87295866 missense probably benign 0.16
R1489:Nox4 UTSW 7 87304889 missense probably damaging 0.99
R1579:Nox4 UTSW 7 87370023 missense probably damaging 0.98
R1669:Nox4 UTSW 7 87295889 missense probably benign 0.01
R1742:Nox4 UTSW 7 87295818 missense possibly damaging 0.82
R1900:Nox4 UTSW 7 87360796 nonsense probably null
R2112:Nox4 UTSW 7 87372008 missense probably damaging 1.00
R2192:Nox4 UTSW 7 87374380 missense probably benign 0.02
R2496:Nox4 UTSW 7 87306750 missense probably benign 0.04
R2497:Nox4 UTSW 7 87295876 nonsense probably null
R4158:Nox4 UTSW 7 87396824 missense possibly damaging 0.95
R4160:Nox4 UTSW 7 87396824 missense possibly damaging 0.95
R4281:Nox4 UTSW 7 87297524 missense possibly damaging 0.77
R4685:Nox4 UTSW 7 87297508 missense probably benign 0.36
R4791:Nox4 UTSW 7 87304847 missense probably benign 0.35
R5001:Nox4 UTSW 7 87360803 missense probably damaging 0.96
R5091:Nox4 UTSW 7 87376242 missense probably damaging 1.00
R5174:Nox4 UTSW 7 87323766 missense probably benign 0.10
R5220:Nox4 UTSW 7 87374408 missense possibly damaging 0.91
R5278:Nox4 UTSW 7 87371926 missense probably damaging 1.00
R5723:Nox4 UTSW 7 87304973 intron probably benign
R5840:Nox4 UTSW 7 87360793 missense probably benign 0.00
R5852:Nox4 UTSW 7 87338964 missense probably damaging 0.98
R7516:Nox4 UTSW 7 87321697 missense probably benign
R7587:Nox4 UTSW 7 87317302 missense probably damaging 1.00
R7643:Nox4 UTSW 7 87323754 missense probably damaging 1.00
R7660:Nox4 UTSW 7 87370022 missense probably damaging 0.97
R7786:Nox4 UTSW 7 87295842 missense probably damaging 0.99
X0021:Nox4 UTSW 7 87395678 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCCAAGCCTGATTCCAAG -3'
(R):5'- AATGCAGTATGCTCTCATTACCTC -3'

Sequencing Primer
(F):5'- GAGATGCATAATGTCCTGTGTACAG -3'
(R):5'- TTACCTCAGCATAATTGGGAGCCG -3'
Posted On2019-10-17