Incidental Mutation 'R7529:Adcy1'
ID583206
Institutional Source Beutler Lab
Gene Symbol Adcy1
Ensembl Gene ENSMUSG00000020431
Gene Nameadenylate cyclase 1
SynonymsI-AC, D11Bwg1392e, AC1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7529 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location7063489-7178506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7139157 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 524 (S524P)
Ref Sequence ENSEMBL: ENSMUSP00000020706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020706]
Predicted Effect probably damaging
Transcript: ENSMUST00000020706
AA Change: S524P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020706
Gene: ENSMUSG00000020431
AA Change: S524P

DomainStartEndE-ValueType
low complexity region 2 36 N/A INTRINSIC
low complexity region 58 90 N/A INTRINSIC
low complexity region 112 135 N/A INTRINSIC
CYCc 257 455 2.05e-80 SMART
transmembrane domain 608 630 N/A INTRINSIC
transmembrane domain 634 656 N/A INTRINSIC
transmembrane domain 676 698 N/A INTRINSIC
CYCc 827 1038 1.71e-50 SMART
low complexity region 1090 1104 N/A INTRINSIC
Meta Mutation Damage Score 0.3171 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the of adenylate cyclase gene family that is primarily expressed in the brain. This protein is regulated by calcium/calmodulin concentration and may be involved in brain development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for an insertional or null mutation fail to develop normal patterned distribution of neurons in the brain and display behavioral and learning abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T A 7: 128,237,164 K86* probably null Het
Ablim3 A C 18: 61,821,968 S317A probably benign Het
Agps C A 2: 75,832,352 A47E possibly damaging Het
Arhgef15 G T 11: 68,954,022 R250S probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atoh8 G T 6: 72,223,841 D288E probably benign Het
B3galt2 A C 1: 143,646,536 K137Q probably benign Het
Cacna2d4 G A 6: 119,270,766 V343I probably benign Het
Cage1 T C 13: 38,025,755 N82S possibly damaging Het
Cep350 A G 1: 155,861,923 S2725P probably benign Het
Cfap65 T C 1: 74,926,610 N414D probably damaging Het
Cgnl1 A C 9: 71,631,758 L1154R probably damaging Het
Cmya5 A T 13: 93,097,434 M382K probably benign Het
Dchs2 G A 3: 83,354,398 V2658M possibly damaging Het
Dlgap5 T C 14: 47,416,419 N51S probably damaging Het
Dnah17 A G 11: 118,049,866 probably null Het
Dnal1 A G 12: 84,131,343 I35V probably benign Het
Dtnbp1 A G 13: 44,931,070 F198S probably damaging Het
Edar A T 10: 58,612,008 S160T probably benign Het
Enpp3 A T 10: 24,798,174 N409K probably damaging Het
Ercc6 T A 14: 32,560,729 C726* probably null Het
Extl2 G A 3: 116,027,406 V301I possibly damaging Het
G2e3 A G 12: 51,371,604 Q594R probably damaging Het
Gal3st2c A G 1: 94,009,317 N328S probably benign Het
Galnt17 A G 5: 131,306,380 V74A probably damaging Het
Ggta1 A G 2: 35,414,244 W76R probably damaging Het
Gm13089 T C 4: 143,702,674 Het
Gm9573 A T 17: 35,619,231 S1354R unknown Het
Gm9772 T A 17: 22,007,159 D48V probably benign Het
Herpud2 T C 9: 25,108,897 T388A probably damaging Het
Ighv5-9-1 A G 12: 113,736,334 S53P possibly damaging Het
Il23r T A 6: 67,490,736 M16L possibly damaging Het
Ints1 G A 5: 139,767,726 A717V possibly damaging Het
Itpr2 A T 6: 146,194,598 L2122Q probably damaging Het
Klrg2 A T 6: 38,630,331 V248E probably damaging Het
Krtap5-5 A G 7: 142,229,692 C74R unknown Het
Luzp1 G T 4: 136,540,932 L155F probably damaging Het
Mcam T C 9: 44,138,895 V209A probably benign Het
Med1 G C 11: 98,155,965 T1335R unknown Het
Mroh2b A G 15: 4,949,009 I1346V probably damaging Het
Mrpl4 C G 9: 21,007,679 Q201E probably benign Het
Mylk2 T C 2: 152,915,704 L326P probably damaging Het
Myot A T 18: 44,346,173 R326* probably null Het
Nox3 T A 17: 3,671,775 R288S probably damaging Het
Nox4 A T 7: 87,395,768 Y572F unknown Het
Olfr1396 A G 11: 49,112,859 L289P probably damaging Het
Olfr1436 A G 19: 12,298,722 S137P probably damaging Het
Pcdhb15 G T 18: 37,474,473 E253* probably null Het
Plcb2 T C 2: 118,710,234 H1052R probably damaging Het
Plpp5 A T 8: 25,724,206 Q250L probably benign Het
Plxna2 T C 1: 194,643,871 Y38H probably benign Het
Pnpla8 A G 12: 44,283,180 K172E probably benign Het
Prl8a9 T A 13: 27,560,528 D110V probably benign Het
Prrx1 T C 1: 163,253,964 probably null Het
Prss52 T A 14: 64,109,588 H70Q probably benign Het
Rcc1 T C 4: 132,334,563 T300A probably benign Het
Rnf114 T C 2: 167,507,094 V64A possibly damaging Het
Rnf168 T C 16: 32,298,914 I431T probably damaging Het
Rnmt A G 18: 68,311,655 M232V probably benign Het
Rrs1 A C 1: 9,546,192 Q223H probably benign Het
Scyl3 A T 1: 163,943,869 L261F probably damaging Het
Slc24a4 A T 12: 102,264,448 T533S probably benign Het
Slc26a2 A G 18: 61,198,358 L667P probably damaging Het
Snrnp40 T A 4: 130,384,482 V260D possibly damaging Het
Snrpa A C 7: 27,189,453 M174R probably benign Het
Ss18l1 C T 2: 180,058,157 A270V possibly damaging Het
Stk19 G T 17: 34,824,656 Q193K probably benign Het
Syne1 T A 10: 5,424,382 I142L probably damaging Het
Tbx2 T C 11: 85,840,901 S675P probably benign Het
Tcaf1 A G 6: 42,675,355 I731T probably damaging Het
Tg G T 15: 66,694,768 G1222W probably damaging Het
Tsc2 A G 17: 24,597,948 F1581L probably damaging Het
Ubr4 G C 4: 139,422,417 V520L probably benign Het
Wls A T 3: 159,873,007 N69Y probably benign Het
Wnk2 A G 13: 49,100,981 F353L possibly damaging Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp64 C T 2: 168,894,072 G562R probably benign Het
Zfp663 T G 2: 165,352,808 E497A probably damaging Het
Zfp995 A T 17: 21,880,352 C300* probably null Het
Other mutations in Adcy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Adcy1 APN 11 7137385 missense probably damaging 0.99
IGL01325:Adcy1 APN 11 7064102 missense possibly damaging 0.58
IGL01531:Adcy1 APN 11 7169414 missense possibly damaging 0.95
IGL01585:Adcy1 APN 11 7167143 missense probably damaging 1.00
IGL01932:Adcy1 APN 11 7100565 splice site probably benign
IGL01945:Adcy1 APN 11 7161891 missense probably damaging 1.00
IGL02532:Adcy1 APN 11 7144737 missense probably benign 0.26
IGL02649:Adcy1 APN 11 7167156 missense probably damaging 1.00
IGL02658:Adcy1 APN 11 7138279 splice site probably benign
IGL02813:Adcy1 APN 11 7146591 missense possibly damaging 0.83
IGL02931:Adcy1 APN 11 7079012 missense probably benign 0.19
IGL03116:Adcy1 APN 11 7150071 missense probably benign
IGL03119:Adcy1 APN 11 7109051 missense probably damaging 1.00
IGL03214:Adcy1 APN 11 7167054 splice site probably benign
PIT4431001:Adcy1 UTSW 11 7064089 missense possibly damaging 0.93
PIT4520001:Adcy1 UTSW 11 7167133 missense probably damaging 1.00
R0032:Adcy1 UTSW 11 7144729 missense possibly damaging 0.93
R0032:Adcy1 UTSW 11 7144729 missense possibly damaging 0.93
R0080:Adcy1 UTSW 11 7149497 splice site probably benign
R0082:Adcy1 UTSW 11 7149497 splice site probably benign
R0238:Adcy1 UTSW 11 7139162 missense possibly damaging 0.80
R0238:Adcy1 UTSW 11 7139162 missense possibly damaging 0.80
R0312:Adcy1 UTSW 11 7149538 missense probably benign 0.08
R0569:Adcy1 UTSW 11 7146514 missense probably benign 0.34
R1055:Adcy1 UTSW 11 7109075 missense probably damaging 1.00
R1144:Adcy1 UTSW 11 7137400 missense probably damaging 1.00
R1179:Adcy1 UTSW 11 7167054 splice site probably null
R1245:Adcy1 UTSW 11 7169410 splice site probably benign
R1467:Adcy1 UTSW 11 7138396 missense probably damaging 0.97
R1467:Adcy1 UTSW 11 7138396 missense probably damaging 0.97
R1823:Adcy1 UTSW 11 7161312 missense probably benign 0.23
R1953:Adcy1 UTSW 11 7078991 missense probably benign 0.01
R1957:Adcy1 UTSW 11 7161945 missense probably benign 0.00
R2029:Adcy1 UTSW 11 7139142 missense probably benign 0.10
R2051:Adcy1 UTSW 11 7161885 nonsense probably null
R2483:Adcy1 UTSW 11 7130348 missense probably benign 0.01
R3108:Adcy1 UTSW 11 7169453 missense probably damaging 1.00
R3623:Adcy1 UTSW 11 7130348 missense probably benign 0.01
R3624:Adcy1 UTSW 11 7130348 missense probably benign 0.01
R4082:Adcy1 UTSW 11 7064117 missense probably damaging 1.00
R4159:Adcy1 UTSW 11 7063889 missense probably damaging 1.00
R4470:Adcy1 UTSW 11 7144804 missense probably benign 0.17
R4472:Adcy1 UTSW 11 7130369 missense probably damaging 1.00
R4951:Adcy1 UTSW 11 7138336 missense possibly damaging 0.83
R4997:Adcy1 UTSW 11 7161298 missense probably benign 0.25
R5237:Adcy1 UTSW 11 7149553 missense probably benign 0.00
R5288:Adcy1 UTSW 11 7161351 missense probably benign 0.01
R5304:Adcy1 UTSW 11 7064198 missense probably benign 0.00
R5341:Adcy1 UTSW 11 7130375 missense probably damaging 0.99
R5379:Adcy1 UTSW 11 7146532 missense probably damaging 1.00
R5592:Adcy1 UTSW 11 7139088 nonsense probably null
R5677:Adcy1 UTSW 11 7161914 missense probably damaging 1.00
R5680:Adcy1 UTSW 11 7109020 missense probably damaging 1.00
R5753:Adcy1 UTSW 11 7130300 missense probably damaging 1.00
R5888:Adcy1 UTSW 11 7139095 missense possibly damaging 0.66
R5943:Adcy1 UTSW 11 7161337 missense probably damaging 1.00
R6435:Adcy1 UTSW 11 7161367 missense possibly damaging 0.60
R6931:Adcy1 UTSW 11 7150884 missense possibly damaging 0.81
R6998:Adcy1 UTSW 11 7079026 missense probably damaging 1.00
R7368:Adcy1 UTSW 11 7144765 missense probably damaging 1.00
R7378:Adcy1 UTSW 11 7169543 missense possibly damaging 0.56
R7393:Adcy1 UTSW 11 7137381 missense probably damaging 1.00
R7500:Adcy1 UTSW 11 7144762 missense probably damaging 1.00
X0027:Adcy1 UTSW 11 7161930 missense possibly damaging 0.47
Z1088:Adcy1 UTSW 11 7150019 missense probably benign 0.19
Z1176:Adcy1 UTSW 11 7109098 missense probably damaging 1.00
Z1176:Adcy1 UTSW 11 7149536 missense probably damaging 0.99
Z1176:Adcy1 UTSW 11 7150857 missense probably damaging 0.96
Z1176:Adcy1 UTSW 11 7150858 missense possibly damaging 0.62
Z1177:Adcy1 UTSW 11 7100642 nonsense probably null
Z1177:Adcy1 UTSW 11 7144802 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTCTTCCTTGCTGGGTAC -3'
(R):5'- TGTGTCAGCTCAAGAACTCC -3'

Sequencing Primer
(F):5'- TACCTGGTAGATCCCTGGGTAC -3'
(R):5'- TAGCCACATAATAGGCTTTCCAGG -3'
Posted On2019-10-17