Incidental Mutation 'R7529:Med1'
ID583210
Institutional Source Beutler Lab
Gene Symbol Med1
Ensembl Gene ENSMUSG00000018160
Gene Namemediator complex subunit 1
SynonymsPparbp, l11Jus15, PBP, TRAP 220, CRSP210, DRIP205, TRAP220
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7529 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location98152154-98193293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 98155965 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 1335 (T1335R)
Ref Sequence ENSEMBL: ENSMUSP00000103169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018304] [ENSMUST00000092735] [ENSMUST00000107545]
Predicted Effect unknown
Transcript: ENSMUST00000018304
AA Change: T1320R
SMART Domains Protein: ENSMUSP00000018304
Gene: ENSMUSG00000018160
AA Change: T1320R

DomainStartEndE-ValueType
Pfam:Med1 18 414 3.7e-112 PFAM
low complexity region 536 559 N/A INTRINSIC
low complexity region 595 619 N/A INTRINSIC
low complexity region 667 678 N/A INTRINSIC
low complexity region 960 981 N/A INTRINSIC
low complexity region 989 999 N/A INTRINSIC
low complexity region 1015 1036 N/A INTRINSIC
low complexity region 1042 1054 N/A INTRINSIC
low complexity region 1063 1138 N/A INTRINSIC
low complexity region 1170 1183 N/A INTRINSIC
low complexity region 1205 1243 N/A INTRINSIC
low complexity region 1250 1281 N/A INTRINSIC
low complexity region 1344 1364 N/A INTRINSIC
low complexity region 1482 1503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092735
SMART Domains Protein: ENSMUSP00000090411
Gene: ENSMUSG00000018160

DomainStartEndE-ValueType
Pfam:Med1 33 429 1.2e-113 PFAM
transmembrane domain 585 607 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000107545
AA Change: T1335R
SMART Domains Protein: ENSMUSP00000103169
Gene: ENSMUSG00000018160
AA Change: T1335R

DomainStartEndE-ValueType
Pfam:Med1 59 426 2.9e-74 PFAM
low complexity region 551 574 N/A INTRINSIC
low complexity region 610 634 N/A INTRINSIC
low complexity region 682 693 N/A INTRINSIC
low complexity region 975 996 N/A INTRINSIC
low complexity region 1004 1014 N/A INTRINSIC
low complexity region 1030 1051 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1078 1153 N/A INTRINSIC
low complexity region 1185 1198 N/A INTRINSIC
low complexity region 1220 1258 N/A INTRINSIC
low complexity region 1265 1296 N/A INTRINSIC
low complexity region 1359 1379 N/A INTRINSIC
low complexity region 1497 1518 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. It also regulates p53-dependent apoptosis and it is essential for adipogenesis. This protein is known to have the ability to self-oligomerize. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have defects of placental vasculature, heart, and lens, arrested erythrocytic differentiation, impaired neuronal development, and die by embryonic day 11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T A 7: 128,237,164 K86* probably null Het
Ablim3 A C 18: 61,821,968 S317A probably benign Het
Adcy1 T C 11: 7,139,157 S524P probably damaging Het
Agps C A 2: 75,832,352 A47E possibly damaging Het
Arhgef15 G T 11: 68,954,022 R250S probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atoh8 G T 6: 72,223,841 D288E probably benign Het
B3galt2 A C 1: 143,646,536 K137Q probably benign Het
Cacna2d4 G A 6: 119,270,766 V343I probably benign Het
Cage1 T C 13: 38,025,755 N82S possibly damaging Het
Cep350 A G 1: 155,861,923 S2725P probably benign Het
Cfap65 T C 1: 74,926,610 N414D probably damaging Het
Cgnl1 A C 9: 71,631,758 L1154R probably damaging Het
Cmya5 A T 13: 93,097,434 M382K probably benign Het
Dchs2 G A 3: 83,354,398 V2658M possibly damaging Het
Dlgap5 T C 14: 47,416,419 N51S probably damaging Het
Dnah17 A G 11: 118,049,866 probably null Het
Dnal1 A G 12: 84,131,343 I35V probably benign Het
Dtnbp1 A G 13: 44,931,070 F198S probably damaging Het
Edar A T 10: 58,612,008 S160T probably benign Het
Enpp3 A T 10: 24,798,174 N409K probably damaging Het
Ercc6 T A 14: 32,560,729 C726* probably null Het
Extl2 G A 3: 116,027,406 V301I possibly damaging Het
G2e3 A G 12: 51,371,604 Q594R probably damaging Het
Gal3st2c A G 1: 94,009,317 N328S probably benign Het
Galnt17 A G 5: 131,306,380 V74A probably damaging Het
Ggta1 A G 2: 35,414,244 W76R probably damaging Het
Gm13089 T C 4: 143,702,674 Het
Gm9573 A T 17: 35,619,231 S1354R unknown Het
Gm9772 T A 17: 22,007,159 D48V probably benign Het
Herpud2 T C 9: 25,108,897 T388A probably damaging Het
Ighv5-9-1 A G 12: 113,736,334 S53P possibly damaging Het
Il23r T A 6: 67,490,736 M16L possibly damaging Het
Ints1 G A 5: 139,767,726 A717V possibly damaging Het
Itpr2 A T 6: 146,194,598 L2122Q probably damaging Het
Klrg2 A T 6: 38,630,331 V248E probably damaging Het
Krtap5-5 A G 7: 142,229,692 C74R unknown Het
Luzp1 G T 4: 136,540,932 L155F probably damaging Het
Mcam T C 9: 44,138,895 V209A probably benign Het
Mroh2b A G 15: 4,949,009 I1346V probably damaging Het
Mrpl4 C G 9: 21,007,679 Q201E probably benign Het
Mylk2 T C 2: 152,915,704 L326P probably damaging Het
Myot A T 18: 44,346,173 R326* probably null Het
Nox3 T A 17: 3,671,775 R288S probably damaging Het
Nox4 A T 7: 87,395,768 Y572F unknown Het
Olfr1396 A G 11: 49,112,859 L289P probably damaging Het
Olfr1436 A G 19: 12,298,722 S137P probably damaging Het
Pcdhb15 G T 18: 37,474,473 E253* probably null Het
Plcb2 T C 2: 118,710,234 H1052R probably damaging Het
Plpp5 A T 8: 25,724,206 Q250L probably benign Het
Plxna2 T C 1: 194,643,871 Y38H probably benign Het
Pnpla8 A G 12: 44,283,180 K172E probably benign Het
Prl8a9 T A 13: 27,560,528 D110V probably benign Het
Prrx1 T C 1: 163,253,964 probably null Het
Prss52 T A 14: 64,109,588 H70Q probably benign Het
Rcc1 T C 4: 132,334,563 T300A probably benign Het
Rnf114 T C 2: 167,507,094 V64A possibly damaging Het
Rnf168 T C 16: 32,298,914 I431T probably damaging Het
Rnmt A G 18: 68,311,655 M232V probably benign Het
Rrs1 A C 1: 9,546,192 Q223H probably benign Het
Scyl3 A T 1: 163,943,869 L261F probably damaging Het
Slc24a4 A T 12: 102,264,448 T533S probably benign Het
Slc26a2 A G 18: 61,198,358 L667P probably damaging Het
Snrnp40 T A 4: 130,384,482 V260D possibly damaging Het
Snrpa A C 7: 27,189,453 M174R probably benign Het
Ss18l1 C T 2: 180,058,157 A270V possibly damaging Het
Stk19 G T 17: 34,824,656 Q193K probably benign Het
Syne1 T A 10: 5,424,382 I142L probably damaging Het
Tbx2 T C 11: 85,840,901 S675P probably benign Het
Tcaf1 A G 6: 42,675,355 I731T probably damaging Het
Tg G T 15: 66,694,768 G1222W probably damaging Het
Tsc2 A G 17: 24,597,948 F1581L probably damaging Het
Ubr4 G C 4: 139,422,417 V520L probably benign Het
Wls A T 3: 159,873,007 N69Y probably benign Het
Wnk2 A G 13: 49,100,981 F353L possibly damaging Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp64 C T 2: 168,894,072 G562R probably benign Het
Zfp663 T G 2: 165,352,808 E497A probably damaging Het
Zfp995 A T 17: 21,880,352 C300* probably null Het
Other mutations in Med1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Med1 APN 11 98155684 intron probably benign
IGL00690:Med1 APN 11 98169400 missense possibly damaging 0.94
IGL01087:Med1 APN 11 98180285 missense probably damaging 1.00
IGL01133:Med1 APN 11 98157986 nonsense probably null
IGL02223:Med1 APN 11 98157876 missense probably damaging 1.00
IGL02257:Med1 APN 11 98180270 missense probably damaging 0.98
IGL02699:Med1 APN 11 98180025 missense possibly damaging 0.61
IGL02706:Med1 APN 11 98156707 intron probably benign
IGL02902:Med1 APN 11 98156509 intron probably benign
IGL02986:Med1 APN 11 98156260 intron probably benign
IGL03011:Med1 APN 11 98161033 missense possibly damaging 0.92
IGL03282:Med1 APN 11 98156817 missense probably damaging 1.00
IGL03303:Med1 APN 11 98158352 missense probably damaging 1.00
IGL03342:Med1 APN 11 98189180 critical splice donor site probably null
IGL03410:Med1 APN 11 98189183 missense possibly damaging 0.62
PIT4453001:Med1 UTSW 11 98158417 missense probably benign 0.40
R0040:Med1 UTSW 11 98166255 critical splice donor site probably null
R0206:Med1 UTSW 11 98155689 intron probably benign
R0206:Med1 UTSW 11 98155689 intron probably benign
R0208:Med1 UTSW 11 98155689 intron probably benign
R0310:Med1 UTSW 11 98167574 missense probably benign 0.38
R0505:Med1 UTSW 11 98156904 missense probably damaging 1.00
R0597:Med1 UTSW 11 98169438 missense probably benign 0.08
R0680:Med1 UTSW 11 98180166 intron probably null
R0686:Med1 UTSW 11 98158404 missense probably damaging 1.00
R0698:Med1 UTSW 11 98155689 intron probably benign
R1293:Med1 UTSW 11 98157036 missense possibly damaging 0.93
R1302:Med1 UTSW 11 98157449 missense possibly damaging 0.50
R1365:Med1 UTSW 11 98155995 intron probably benign
R1537:Med1 UTSW 11 98160946 missense probably damaging 0.97
R1609:Med1 UTSW 11 98161170 missense possibly damaging 0.91
R1631:Med1 UTSW 11 98155626 intron probably benign
R1792:Med1 UTSW 11 98157283 missense probably damaging 1.00
R1831:Med1 UTSW 11 98156611 intron probably benign
R1837:Med1 UTSW 11 98169412 missense probably damaging 1.00
R2366:Med1 UTSW 11 98161182 missense probably damaging 0.98
R3754:Med1 UTSW 11 98166722 missense possibly damaging 0.77
R3762:Med1 UTSW 11 98155515 intron probably benign
R4012:Med1 UTSW 11 98171706 missense possibly damaging 0.85
R4112:Med1 UTSW 11 98180087 missense probably damaging 1.00
R4384:Med1 UTSW 11 98152862 unclassified probably benign
R4579:Med1 UTSW 11 98158422 missense possibly damaging 0.56
R4740:Med1 UTSW 11 98180264 nonsense probably null
R4819:Med1 UTSW 11 98155432 intron probably benign
R4879:Med1 UTSW 11 98155360 unclassified probably benign
R4993:Med1 UTSW 11 98163904 missense probably damaging 1.00
R5040:Med1 UTSW 11 98155404 intron probably benign
R5249:Med1 UTSW 11 98157240 missense probably benign 0.43
R5373:Med1 UTSW 11 98163963 missense probably damaging 0.99
R5374:Med1 UTSW 11 98163963 missense probably damaging 0.99
R5552:Med1 UTSW 11 98166331 nonsense probably null
R5692:Med1 UTSW 11 98156380 intron probably benign
R6010:Med1 UTSW 11 98158362 missense probably damaging 1.00
R6149:Med1 UTSW 11 98183853 missense possibly damaging 0.74
R6417:Med1 UTSW 11 98157228 missense probably damaging 0.97
R7301:Med1 UTSW 11 98152808 missense probably benign 0.23
R7507:Med1 UTSW 11 98158026 missense probably damaging 1.00
R7588:Med1 UTSW 11 98155572 missense unknown
R7654:Med1 UTSW 11 98169363 missense possibly damaging 0.75
R7662:Med1 UTSW 11 98155392 missense unknown
R7679:Med1 UTSW 11 98156061 missense unknown
R7862:Med1 UTSW 11 98161210 missense probably benign 0.05
R7945:Med1 UTSW 11 98161210 missense probably benign 0.05
Z1176:Med1 UTSW 11 98161183 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CCGTCGTGCTTGCTGATAATG -3'
(R):5'- TTCAGGGTCAGCATCCTCAG -3'

Sequencing Primer
(F):5'- GCTTGCTGATAATGATTTTTGCCAC -3'
(R):5'- TCAGCATCCTCAGGCTCAGTG -3'
Posted On2019-10-17