Incidental Mutation 'R7529:Wnk2'
ID583220
Institutional Source Beutler Lab
Gene Symbol Wnk2
Ensembl Gene ENSMUSG00000037989
Gene NameWNK lysine deficient protein kinase 2
SynonymsESTM15, X83337, 1810073P09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R7529 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location49036303-49148014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49100981 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 353 (F353L)
Ref Sequence ENSEMBL: ENSMUSP00000047231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035538] [ENSMUST00000049265] [ENSMUST00000091623] [ENSMUST00000110096] [ENSMUST00000110097] [ENSMUST00000159559] [ENSMUST00000162403] [ENSMUST00000162581]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035538
AA Change: F353L

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000047231
Gene: ENSMUSG00000037989
AA Change: F353L

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.5e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.6e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 6.72e-6 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
low complexity region 2033 2053 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000049265
AA Change: F353L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049327
Gene: ENSMUSG00000037989
AA Change: F353L

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
S_TKc 195 453 3.3e-19 SMART
Pfam:OSR1_C 474 511 5.6e-19 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 9.51e-6 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
internal_repeat_2 1611 1703 2.12e-5 PROSPERO
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
internal_repeat_2 1923 2023 2.12e-5 PROSPERO
low complexity region 2069 2089 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000091623
AA Change: F353L

PolyPhen 2 Score 0.632 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000089212
Gene: ENSMUSG00000037989
AA Change: F353L

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 1.6e-41 PFAM
Pfam:Pkinase 195 453 1e-54 PFAM
Pfam:OSR1_C 474 511 4e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 1.52e-5 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
internal_repeat_2 1611 1713 7.41e-5 PROSPERO
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
internal_repeat_2 1923 2027 7.41e-5 PROSPERO
low complexity region 2117 2137 N/A INTRINSIC
low complexity region 2191 2202 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000110096
AA Change: F353L
SMART Domains Protein: ENSMUSP00000105723
Gene: ENSMUSG00000037989
AA Change: F353L

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.6e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.6e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 1015 1038 N/A INTRINSIC
internal_repeat_1 1064 1087 2.89e-5 PROSPERO
low complexity region 1177 1194 N/A INTRINSIC
low complexity region 1219 1255 N/A INTRINSIC
low complexity region 1331 1343 N/A INTRINSIC
low complexity region 1351 1359 N/A INTRINSIC
low complexity region 1366 1391 N/A INTRINSIC
low complexity region 1489 1498 N/A INTRINSIC
low complexity region 1721 1732 N/A INTRINSIC
coiled coil region 1737 1768 N/A INTRINSIC
low complexity region 2018 2038 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110097
AA Change: F353L

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105724
Gene: ENSMUSG00000037989
AA Change: F353L

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.7e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.8e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 1.16e-5 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
internal_repeat_2 1611 1713 5.74e-5 PROSPERO
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
internal_repeat_2 1923 2027 5.74e-5 PROSPERO
low complexity region 2117 2137 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159559
AA Change: F353L

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123915
Gene: ENSMUSG00000037989
AA Change: F353L

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.7e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.8e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 736 N/A INTRINSIC
low complexity region 759 791 N/A INTRINSIC
low complexity region 809 819 N/A INTRINSIC
low complexity region 828 842 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 926 942 N/A INTRINSIC
low complexity region 971 1002 N/A INTRINSIC
low complexity region 1009 1036 N/A INTRINSIC
low complexity region 1101 1124 N/A INTRINSIC
internal_repeat_1 1150 1173 7.19e-6 PROSPERO
low complexity region 1263 1280 N/A INTRINSIC
low complexity region 1305 1341 N/A INTRINSIC
low complexity region 1417 1429 N/A INTRINSIC
low complexity region 1437 1445 N/A INTRINSIC
low complexity region 1452 1477 N/A INTRINSIC
low complexity region 1575 1585 N/A INTRINSIC
internal_repeat_2 1599 1701 3.66e-5 PROSPERO
low complexity region 1808 1819 N/A INTRINSIC
coiled coil region 1824 1855 N/A INTRINSIC
internal_repeat_2 1911 2015 3.66e-5 PROSPERO
low complexity region 2105 2125 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162403
AA Change: F353L

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125539
Gene: ENSMUSG00000037989
AA Change: F353L

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.3e-42 PFAM
Pfam:Pkinase 195 453 1.6e-56 PFAM
Pfam:OSR1_C 474 511 5.3e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 736 N/A INTRINSIC
low complexity region 759 791 N/A INTRINSIC
low complexity region 809 819 N/A INTRINSIC
low complexity region 828 842 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 926 942 N/A INTRINSIC
low complexity region 1003 1026 N/A INTRINSIC
internal_repeat_1 1052 1075 1.05e-5 PROSPERO
low complexity region 1165 1182 N/A INTRINSIC
low complexity region 1207 1243 N/A INTRINSIC
low complexity region 1319 1331 N/A INTRINSIC
low complexity region 1339 1347 N/A INTRINSIC
low complexity region 1354 1379 N/A INTRINSIC
low complexity region 1477 1487 N/A INTRINSIC
internal_repeat_2 1501 1593 2.32e-5 PROSPERO
low complexity region 1710 1721 N/A INTRINSIC
coiled coil region 1726 1757 N/A INTRINSIC
internal_repeat_2 1813 1913 2.32e-5 PROSPERO
low complexity region 1959 1979 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162581
AA Change: F353L

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125448
Gene: ENSMUSG00000037989
AA Change: F353L

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.5e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.6e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 6.72e-6 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
low complexity region 2033 2053 N/A INTRINSIC
Meta Mutation Damage Score 0.3056 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic serine-threonine kinase that belongs to the protein kinase superfamily. The protein plays an important role in the regulation of electrolyte homeostasis, cell signaling survival, and proliferation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T A 7: 128,237,164 K86* probably null Het
Ablim3 A C 18: 61,821,968 S317A probably benign Het
Adcy1 T C 11: 7,139,157 S524P probably damaging Het
Agps C A 2: 75,832,352 A47E possibly damaging Het
Arhgef15 G T 11: 68,954,022 R250S probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atoh8 G T 6: 72,223,841 D288E probably benign Het
B3galt2 A C 1: 143,646,536 K137Q probably benign Het
Cacna2d4 G A 6: 119,270,766 V343I probably benign Het
Cage1 T C 13: 38,025,755 N82S possibly damaging Het
Cep350 A G 1: 155,861,923 S2725P probably benign Het
Cfap65 T C 1: 74,926,610 N414D probably damaging Het
Cgnl1 A C 9: 71,631,758 L1154R probably damaging Het
Cmya5 A T 13: 93,097,434 M382K probably benign Het
Dchs2 G A 3: 83,354,398 V2658M possibly damaging Het
Dlgap5 T C 14: 47,416,419 N51S probably damaging Het
Dnah17 A G 11: 118,049,866 probably null Het
Dnal1 A G 12: 84,131,343 I35V probably benign Het
Dtnbp1 A G 13: 44,931,070 F198S probably damaging Het
Edar A T 10: 58,612,008 S160T probably benign Het
Enpp3 A T 10: 24,798,174 N409K probably damaging Het
Ercc6 T A 14: 32,560,729 C726* probably null Het
Extl2 G A 3: 116,027,406 V301I possibly damaging Het
G2e3 A G 12: 51,371,604 Q594R probably damaging Het
Gal3st2c A G 1: 94,009,317 N328S probably benign Het
Galnt17 A G 5: 131,306,380 V74A probably damaging Het
Ggta1 A G 2: 35,414,244 W76R probably damaging Het
Gm13089 T C 4: 143,702,674 Het
Gm9573 A T 17: 35,619,231 S1354R unknown Het
Gm9772 T A 17: 22,007,159 D48V probably benign Het
Herpud2 T C 9: 25,108,897 T388A probably damaging Het
Ighv5-9-1 A G 12: 113,736,334 S53P possibly damaging Het
Il23r T A 6: 67,490,736 M16L possibly damaging Het
Ints1 G A 5: 139,767,726 A717V possibly damaging Het
Itpr2 A T 6: 146,194,598 L2122Q probably damaging Het
Klrg2 A T 6: 38,630,331 V248E probably damaging Het
Krtap5-5 A G 7: 142,229,692 C74R unknown Het
Luzp1 G T 4: 136,540,932 L155F probably damaging Het
Mcam T C 9: 44,138,895 V209A probably benign Het
Med1 G C 11: 98,155,965 T1335R unknown Het
Mroh2b A G 15: 4,949,009 I1346V probably damaging Het
Mrpl4 C G 9: 21,007,679 Q201E probably benign Het
Mylk2 T C 2: 152,915,704 L326P probably damaging Het
Myot A T 18: 44,346,173 R326* probably null Het
Nox3 T A 17: 3,671,775 R288S probably damaging Het
Nox4 A T 7: 87,395,768 Y572F unknown Het
Olfr1396 A G 11: 49,112,859 L289P probably damaging Het
Olfr1436 A G 19: 12,298,722 S137P probably damaging Het
Pcdhb15 G T 18: 37,474,473 E253* probably null Het
Plcb2 T C 2: 118,710,234 H1052R probably damaging Het
Plpp5 A T 8: 25,724,206 Q250L probably benign Het
Plxna2 T C 1: 194,643,871 Y38H probably benign Het
Pnpla8 A G 12: 44,283,180 K172E probably benign Het
Prl8a9 T A 13: 27,560,528 D110V probably benign Het
Prrx1 T C 1: 163,253,964 probably null Het
Prss52 T A 14: 64,109,588 H70Q probably benign Het
Rcc1 T C 4: 132,334,563 T300A probably benign Het
Rnf114 T C 2: 167,507,094 V64A possibly damaging Het
Rnf168 T C 16: 32,298,914 I431T probably damaging Het
Rnmt A G 18: 68,311,655 M232V probably benign Het
Rrs1 A C 1: 9,546,192 Q223H probably benign Het
Scyl3 A T 1: 163,943,869 L261F probably damaging Het
Slc24a4 A T 12: 102,264,448 T533S probably benign Het
Slc26a2 A G 18: 61,198,358 L667P probably damaging Het
Snrnp40 T A 4: 130,384,482 V260D possibly damaging Het
Snrpa A C 7: 27,189,453 M174R probably benign Het
Ss18l1 C T 2: 180,058,157 A270V possibly damaging Het
Stk19 G T 17: 34,824,656 Q193K probably benign Het
Syne1 T A 10: 5,424,382 I142L probably damaging Het
Tbx2 T C 11: 85,840,901 S675P probably benign Het
Tcaf1 A G 6: 42,675,355 I731T probably damaging Het
Tg G T 15: 66,694,768 G1222W probably damaging Het
Tsc2 A G 17: 24,597,948 F1581L probably damaging Het
Ubr4 G C 4: 139,422,417 V520L probably benign Het
Wls A T 3: 159,873,007 N69Y probably benign Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp64 C T 2: 168,894,072 G562R probably benign Het
Zfp663 T G 2: 165,352,808 E497A probably damaging Het
Zfp995 A T 17: 21,880,352 C300* probably null Het
Other mutations in Wnk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Wnk2 APN 13 49068192 missense possibly damaging 0.89
IGL01575:Wnk2 APN 13 49146676 missense probably damaging 1.00
IGL01601:Wnk2 APN 13 49076562 missense probably damaging 1.00
IGL01775:Wnk2 APN 13 49071110 missense probably damaging 1.00
IGL02013:Wnk2 APN 13 49082034 missense possibly damaging 0.46
IGL02016:Wnk2 APN 13 49056905 missense probably damaging 1.00
IGL02167:Wnk2 APN 13 49071125 critical splice acceptor site probably null
IGL02174:Wnk2 APN 13 49057167 missense probably damaging 1.00
IGL02210:Wnk2 APN 13 49090869 missense probably damaging 0.98
IGL02228:Wnk2 APN 13 49056940 missense probably damaging 1.00
IGL02282:Wnk2 APN 13 49068125 missense probably damaging 1.00
IGL02319:Wnk2 APN 13 49061438 missense possibly damaging 0.73
IGL02394:Wnk2 APN 13 49081899 splice site probably null
IGL02624:Wnk2 APN 13 49102802 missense probably damaging 1.00
IGL02743:Wnk2 APN 13 49095444 missense probably damaging 1.00
IGL03012:Wnk2 APN 13 49044389 missense probably damaging 0.99
IGL03166:Wnk2 APN 13 49071044 nonsense probably null
R0034:Wnk2 UTSW 13 49068080 missense possibly damaging 0.64
R0385:Wnk2 UTSW 13 49068128 missense probably damaging 1.00
R0423:Wnk2 UTSW 13 49095418 missense possibly damaging 0.91
R0504:Wnk2 UTSW 13 49085394 missense possibly damaging 0.92
R0504:Wnk2 UTSW 13 49085396 missense probably damaging 1.00
R0653:Wnk2 UTSW 13 49057016 missense possibly damaging 0.85
R1135:Wnk2 UTSW 13 49076558 missense probably damaging 1.00
R1445:Wnk2 UTSW 13 49071110 missense probably damaging 1.00
R1464:Wnk2 UTSW 13 49081975 missense probably damaging 1.00
R1464:Wnk2 UTSW 13 49081975 missense probably damaging 1.00
R1468:Wnk2 UTSW 13 49082095 missense probably damaging 0.99
R1468:Wnk2 UTSW 13 49082095 missense probably damaging 0.99
R1480:Wnk2 UTSW 13 49057232 missense probably damaging 1.00
R1605:Wnk2 UTSW 13 49060894 missense probably damaging 1.00
R1719:Wnk2 UTSW 13 49060726 missense possibly damaging 0.76
R1891:Wnk2 UTSW 13 49052724 nonsense probably null
R1966:Wnk2 UTSW 13 49039011 missense probably damaging 0.96
R2001:Wnk2 UTSW 13 49078682 missense possibly damaging 0.61
R2310:Wnk2 UTSW 13 49050577 missense probably damaging 0.97
R2356:Wnk2 UTSW 13 49039168 nonsense probably null
R2406:Wnk2 UTSW 13 49061488 missense possibly damaging 0.86
R2519:Wnk2 UTSW 13 49071029 missense probably damaging 0.99
R3962:Wnk2 UTSW 13 49070977 missense probably damaging 1.00
R4160:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4161:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4226:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4227:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4234:Wnk2 UTSW 13 49061128 missense probably benign 0.33
R4304:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4308:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4584:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4655:Wnk2 UTSW 13 49056883 missense probably damaging 1.00
R4715:Wnk2 UTSW 13 49147232 start codon destroyed unknown
R4887:Wnk2 UTSW 13 49071002 missense probably damaging 1.00
R4888:Wnk2 UTSW 13 49071002 missense probably damaging 1.00
R4945:Wnk2 UTSW 13 49057246 missense probably damaging 1.00
R5182:Wnk2 UTSW 13 49061161 missense possibly damaging 0.92
R5243:Wnk2 UTSW 13 49072578 missense possibly damaging 0.51
R5370:Wnk2 UTSW 13 49102961 missense probably damaging 1.00
R5771:Wnk2 UTSW 13 49102800 missense probably damaging 1.00
R5877:Wnk2 UTSW 13 49067306 missense probably damaging 0.98
R5900:Wnk2 UTSW 13 49102832 missense probably damaging 1.00
R5905:Wnk2 UTSW 13 49076345 missense probably damaging 0.99
R5912:Wnk2 UTSW 13 49060774 missense probably damaging 1.00
R5915:Wnk2 UTSW 13 49078085 missense probably damaging 0.99
R6028:Wnk2 UTSW 13 49076345 missense probably damaging 0.99
R6074:Wnk2 UTSW 13 49051399 missense probably damaging 1.00
R6171:Wnk2 UTSW 13 49060832 missense probably damaging 1.00
R6368:Wnk2 UTSW 13 49061338 missense probably damaging 0.99
R6467:Wnk2 UTSW 13 49146605 missense probably damaging 1.00
R6501:Wnk2 UTSW 13 49146683 missense probably damaging 1.00
R6849:Wnk2 UTSW 13 49067358 missense probably damaging 1.00
R6898:Wnk2 UTSW 13 49071081 missense probably damaging 1.00
R6949:Wnk2 UTSW 13 49101140 missense probably damaging 1.00
R7011:Wnk2 UTSW 13 49071091 missense probably damaging 0.99
R7097:Wnk2 UTSW 13 49102838 missense possibly damaging 0.86
R7121:Wnk2 UTSW 13 49147177 missense probably benign 0.26
R7123:Wnk2 UTSW 13 49081986 missense possibly damaging 0.90
R7423:Wnk2 UTSW 13 49038132 missense probably benign 0.07
R7502:Wnk2 UTSW 13 49147244 splice site probably null
R7751:Wnk2 UTSW 13 49078017 missense unknown
RF023:Wnk2 UTSW 13 49146779 missense probably benign 0.00
X0025:Wnk2 UTSW 13 49060942 missense probably damaging 0.99
X0063:Wnk2 UTSW 13 49038977 missense probably benign 0.00
Z1176:Wnk2 UTSW 13 49038061 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGTATTTCCAGGCAAGCTGG -3'
(R):5'- GGTTCAAGGTGATGAAGCCG -3'

Sequencing Primer
(F):5'- CAAGCTGGAAGGCAGTGTCC -3'
(R):5'- CGAAGGTACTGAGGAGCTGGTG -3'
Posted On2019-10-17