Incidental Mutation 'R7529:Ercc6'
ID583222
Institutional Source Beutler Lab
Gene Symbol Ercc6
Ensembl Gene ENSMUSG00000054051
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 6
SynonymsCS group B correcting gene, C130058G22Rik, CSB
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.511) question?
Stock #R7529 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location32513521-32580990 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 32560729 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 726 (C726*)
Ref Sequence ENSEMBL: ENSMUSP00000066256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066807]
Predicted Effect probably null
Transcript: ENSMUST00000066807
AA Change: C726*
SMART Domains Protein: ENSMUSP00000066256
Gene: ENSMUSG00000054051
AA Change: C726*

DomainStartEndE-ValueType
PDB:4CVO|A 82 160 1e-36 PDB
low complexity region 286 299 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
low complexity region 460 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
DEXDc 499 699 8.34e-33 SMART
Blast:DEXDc 720 821 7e-56 BLAST
HELICc 865 948 1.41e-21 SMART
low complexity region 1364 1377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228549
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein that is important in transcription-coupled excision repair. The encoded protein has ATP-stimulated ATPase activity, interacts with several transcription and excision repair proteins, and may promote complex formation at DNA repair sites. Mutations in this gene are associated with Cockayne syndrome type B and cerebrooculofacioskeletal syndrome 1. Alternative splicing occurs between a splice site from exon 5 of this gene to the 3' splice site upstream of the open reading frame (ORF) of the adjacent gene, piggyback-derived-3 (GeneID:267004), which activates the alternative polyadenylation site downstream of the piggyback-derived-3 ORF. The resulting transcripts encode a fusion protein that shares sequence with the product of each individual gene. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice exhibit UV sensitivity, inactivation of transcription-coupled repair, increased incidence of induced skin and eye tumors, circling behavior, impaired coordination and lower body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T A 7: 128,237,164 K86* probably null Het
Ablim3 A C 18: 61,821,968 S317A probably benign Het
Adcy1 T C 11: 7,139,157 S524P probably damaging Het
Agps C A 2: 75,832,352 A47E possibly damaging Het
Arhgef15 G T 11: 68,954,022 R250S probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atoh8 G T 6: 72,223,841 D288E probably benign Het
B3galt2 A C 1: 143,646,536 K137Q probably benign Het
Cacna2d4 G A 6: 119,270,766 V343I probably benign Het
Cage1 T C 13: 38,025,755 N82S possibly damaging Het
Cep350 A G 1: 155,861,923 S2725P probably benign Het
Cfap65 T C 1: 74,926,610 N414D probably damaging Het
Cgnl1 A C 9: 71,631,758 L1154R probably damaging Het
Cmya5 A T 13: 93,097,434 M382K probably benign Het
Dchs2 G A 3: 83,354,398 V2658M possibly damaging Het
Dlgap5 T C 14: 47,416,419 N51S probably damaging Het
Dnah17 A G 11: 118,049,866 probably null Het
Dnal1 A G 12: 84,131,343 I35V probably benign Het
Dtnbp1 A G 13: 44,931,070 F198S probably damaging Het
Edar A T 10: 58,612,008 S160T probably benign Het
Enpp3 A T 10: 24,798,174 N409K probably damaging Het
Extl2 G A 3: 116,027,406 V301I possibly damaging Het
G2e3 A G 12: 51,371,604 Q594R probably damaging Het
Gal3st2c A G 1: 94,009,317 N328S probably benign Het
Galnt17 A G 5: 131,306,380 V74A probably damaging Het
Ggta1 A G 2: 35,414,244 W76R probably damaging Het
Gm13089 T C 4: 143,702,674 Het
Gm9573 A T 17: 35,619,231 S1354R unknown Het
Gm9772 T A 17: 22,007,159 D48V probably benign Het
Herpud2 T C 9: 25,108,897 T388A probably damaging Het
Ighv5-9-1 A G 12: 113,736,334 S53P possibly damaging Het
Il23r T A 6: 67,490,736 M16L possibly damaging Het
Ints1 G A 5: 139,767,726 A717V possibly damaging Het
Itpr2 A T 6: 146,194,598 L2122Q probably damaging Het
Klrg2 A T 6: 38,630,331 V248E probably damaging Het
Krtap5-5 A G 7: 142,229,692 C74R unknown Het
Luzp1 G T 4: 136,540,932 L155F probably damaging Het
Mcam T C 9: 44,138,895 V209A probably benign Het
Med1 G C 11: 98,155,965 T1335R unknown Het
Mroh2b A G 15: 4,949,009 I1346V probably damaging Het
Mrpl4 C G 9: 21,007,679 Q201E probably benign Het
Mylk2 T C 2: 152,915,704 L326P probably damaging Het
Myot A T 18: 44,346,173 R326* probably null Het
Nox3 T A 17: 3,671,775 R288S probably damaging Het
Nox4 A T 7: 87,395,768 Y572F unknown Het
Olfr1396 A G 11: 49,112,859 L289P probably damaging Het
Olfr1436 A G 19: 12,298,722 S137P probably damaging Het
Pcdhb15 G T 18: 37,474,473 E253* probably null Het
Plcb2 T C 2: 118,710,234 H1052R probably damaging Het
Plpp5 A T 8: 25,724,206 Q250L probably benign Het
Plxna2 T C 1: 194,643,871 Y38H probably benign Het
Pnpla8 A G 12: 44,283,180 K172E probably benign Het
Prl8a9 T A 13: 27,560,528 D110V probably benign Het
Prrx1 T C 1: 163,253,964 probably null Het
Prss52 T A 14: 64,109,588 H70Q probably benign Het
Rcc1 T C 4: 132,334,563 T300A probably benign Het
Rnf114 T C 2: 167,507,094 V64A possibly damaging Het
Rnf168 T C 16: 32,298,914 I431T probably damaging Het
Rnmt A G 18: 68,311,655 M232V probably benign Het
Rrs1 A C 1: 9,546,192 Q223H probably benign Het
Scyl3 A T 1: 163,943,869 L261F probably damaging Het
Slc24a4 A T 12: 102,264,448 T533S probably benign Het
Slc26a2 A G 18: 61,198,358 L667P probably damaging Het
Snrnp40 T A 4: 130,384,482 V260D possibly damaging Het
Snrpa A C 7: 27,189,453 M174R probably benign Het
Ss18l1 C T 2: 180,058,157 A270V possibly damaging Het
Stk19 G T 17: 34,824,656 Q193K probably benign Het
Syne1 T A 10: 5,424,382 I142L probably damaging Het
Tbx2 T C 11: 85,840,901 S675P probably benign Het
Tcaf1 A G 6: 42,675,355 I731T probably damaging Het
Tg G T 15: 66,694,768 G1222W probably damaging Het
Tsc2 A G 17: 24,597,948 F1581L probably damaging Het
Ubr4 G C 4: 139,422,417 V520L probably benign Het
Wls A T 3: 159,873,007 N69Y probably benign Het
Wnk2 A G 13: 49,100,981 F353L possibly damaging Het
Xkr6 G T 14: 63,819,161 V430F probably benign Het
Zfp64 C T 2: 168,894,072 G562R probably benign Het
Zfp663 T G 2: 165,352,808 E497A probably damaging Het
Zfp995 A T 17: 21,880,352 C300* probably null Het
Other mutations in Ercc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ercc6 APN 14 32568072 missense probably damaging 1.00
IGL00796:Ercc6 APN 14 32570002 missense probably benign 0.01
IGL00916:Ercc6 APN 14 32562655 intron probably benign
IGL01743:Ercc6 APN 14 32552604 missense probably damaging 1.00
IGL01802:Ercc6 APN 14 32562574 missense probably damaging 0.99
IGL01886:Ercc6 APN 14 32569580 missense possibly damaging 0.90
IGL02100:Ercc6 APN 14 32517095 missense probably benign 0.00
IGL02115:Ercc6 APN 14 32576993 missense probably damaging 1.00
IGL02755:Ercc6 APN 14 32575748 splice site probably benign
IGL02964:Ercc6 APN 14 32570103 missense probably benign 0.00
IGL02998:Ercc6 APN 14 32557857 missense probably benign 0.05
IGL03150:Ercc6 APN 14 32558574 missense probably damaging 0.96
R0152:Ercc6 UTSW 14 32546905 critical splice donor site probably benign
R0519:Ercc6 UTSW 14 32526842 missense probably damaging 1.00
R0591:Ercc6 UTSW 14 32558016 splice site probably benign
R0894:Ercc6 UTSW 14 32517028 missense probably benign 0.05
R0946:Ercc6 UTSW 14 32552621 missense probably benign 0.08
R1313:Ercc6 UTSW 14 32552720 splice site probably benign
R1506:Ercc6 UTSW 14 32569864 missense probably benign 0.01
R1528:Ercc6 UTSW 14 32519022 missense probably damaging 0.98
R1711:Ercc6 UTSW 14 32526176 missense probably damaging 1.00
R1753:Ercc6 UTSW 14 32576999 missense probably benign
R1795:Ercc6 UTSW 14 32517028 missense probably benign 0.05
R1843:Ercc6 UTSW 14 32546820 missense probably damaging 0.99
R1853:Ercc6 UTSW 14 32576816 missense possibly damaging 0.86
R1859:Ercc6 UTSW 14 32526778 missense probably damaging 1.00
R1912:Ercc6 UTSW 14 32576803 missense probably damaging 1.00
R2308:Ercc6 UTSW 14 32566409 missense possibly damaging 0.70
R2322:Ercc6 UTSW 14 32526317 missense probably damaging 1.00
R2386:Ercc6 UTSW 14 32541359 splice site probably null
R4170:Ercc6 UTSW 14 32566797 missense probably damaging 1.00
R4369:Ercc6 UTSW 14 32517207 missense probably damaging 0.96
R4389:Ercc6 UTSW 14 32574908 nonsense probably null
R4747:Ercc6 UTSW 14 32569907 missense probably benign 0.00
R4811:Ercc6 UTSW 14 32574929 missense probably benign 0.20
R4840:Ercc6 UTSW 14 32541296 missense probably damaging 1.00
R4973:Ercc6 UTSW 14 32574902 missense probably damaging 1.00
R5068:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5069:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5070:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5093:Ercc6 UTSW 14 32567522 missense probably damaging 1.00
R5265:Ercc6 UTSW 14 32569623 missense probably benign 0.01
R5272:Ercc6 UTSW 14 32519028 nonsense probably null
R5499:Ercc6 UTSW 14 32516959 start codon destroyed probably null 0.98
R5795:Ercc6 UTSW 14 32526352 missense probably damaging 0.98
R6258:Ercc6 UTSW 14 32557856 missense probably benign 0.00
R6260:Ercc6 UTSW 14 32557856 missense probably benign 0.00
R6267:Ercc6 UTSW 14 32526403 nonsense probably null
R6291:Ercc6 UTSW 14 32569986 missense probably benign 0.01
R6296:Ercc6 UTSW 14 32526403 nonsense probably null
R6361:Ercc6 UTSW 14 32517110 missense probably benign 0.00
R6500:Ercc6 UTSW 14 32526823 missense probably damaging 0.96
R6555:Ercc6 UTSW 14 32517107 missense probably benign 0.15
R6724:Ercc6 UTSW 14 32566331 missense probably benign 0.01
R6925:Ercc6 UTSW 14 32562608 missense probably damaging 0.99
R7143:Ercc6 UTSW 14 32570305 missense probably damaging 1.00
R7327:Ercc6 UTSW 14 32526404 missense probably benign 0.19
R7396:Ercc6 UTSW 14 32569805 missense probably benign 0.00
R7609:Ercc6 UTSW 14 32566361 missense probably benign 0.11
R7802:Ercc6 UTSW 14 32517303 missense probably damaging 1.00
R7854:Ercc6 UTSW 14 32566292 missense probably damaging 1.00
R7937:Ercc6 UTSW 14 32566292 missense probably damaging 1.00
R7995:Ercc6 UTSW 14 32562569 missense probably damaging 0.99
Z1176:Ercc6 UTSW 14 32526487 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- ATTTTGAAAGGTGCCATCCCC -3'
(R):5'- CATGTGTTAACAGAGGGAAACTC -3'

Sequencing Primer
(F):5'- GGAGCATCCAGAACTTGA -3'
(R):5'- TGGGTACAGTCACCAGCAG -3'
Posted On2019-10-17