Incidental Mutation 'R7530:Kif28'
ID583242
Institutional Source Beutler Lab
Gene Symbol Kif28
Ensembl Gene ENSMUSG00000087236
Gene Namekinesin family member 28
SynonymsLOC383592, Gm1305
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.439) question?
Stock #R7530 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location179695297-179745271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 179708480 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 543 (G543D)
Ref Sequence ENSEMBL: ENSMUSP00000152770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000131716] [ENSMUST00000211943] [ENSMUST00000221136]
Predicted Effect
SMART Domains Protein: ENSMUSP00000118935
Gene: ENSMUSG00000087236
AA Change: G543D

DomainStartEndE-ValueType
KISc 3 331 1.02e-120 SMART
low complexity region 343 354 N/A INTRINSIC
FHA 424 473 1.12e-3 SMART
Pfam:KIF1B 615 654 1.3e-7 PFAM
low complexity region 842 857 N/A INTRINSIC
low complexity region 959 973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211943
AA Change: G475D

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000221136
AA Change: G543D

PolyPhen 2 Score 0.310 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,948,721 Y43* probably null Het
6430550D23Rik C T 2: 156,003,920 V6I probably benign Het
AI314180 A G 4: 58,815,317 M1322T probably damaging Het
Atp10a A G 7: 58,773,976 T230A probably benign Het
Atp5g2 A T 15: 102,667,748 M1K probably null Het
Atp8a1 A C 5: 67,745,628 L535R Het
Bsn A G 9: 108,111,956 I2199T probably damaging Het
Ccdc73 A G 2: 104,994,570 T155A Het
Cdc42bpg T G 19: 6,322,275 F1430L probably benign Het
Cdc42bpg G T 19: 6,322,276 V1431L probably benign Het
Chat A T 14: 32,408,958 Y575* probably null Het
Col6a4 A T 9: 106,068,390 C842S probably damaging Het
Coq2 T C 5: 100,674,142 S34G probably benign Het
Crybg1 C T 10: 43,999,073 A680T possibly damaging Het
Ctsr T A 13: 61,163,117 K38N probably damaging Het
Dpm2 T C 2: 32,572,301 F33S probably damaging Het
Ext2 T A 2: 93,661,653 H564L probably benign Het
Fbxl2 G T 9: 113,989,173 H202N probably benign Het
Fra10ac1 A T 19: 38,215,905 Y74* probably null Het
Greb1 T A 12: 16,717,206 I332F probably benign Het
Ifnar2 A G 16: 91,404,313 S481G probably benign Het
Igkv9-123 G A 6: 67,954,397 P62S possibly damaging Het
Iqub T C 6: 24,450,623 Q659R probably benign Het
Kansl2 T C 15: 98,529,015 T242A probably benign Het
Lsg1 A G 16: 30,582,601 S93P possibly damaging Het
Med23 T A 10: 24,905,953 C1052S probably benign Het
Mgam G T 6: 40,709,218 probably null Het
Mtmr4 C T 11: 87,611,876 R919W probably damaging Het
Muc5ac G T 7: 141,813,799 V2986L possibly damaging Het
Myo5b A G 18: 74,731,731 E1340G probably benign Het
Nkd2 T C 13: 73,846,959 D40G possibly damaging Het
Nudt5 T C 2: 5,864,368 L135S probably damaging Het
Oca2 A C 7: 56,331,972 D614A probably damaging Het
Olfr1 A G 11: 73,388,363 V221A possibly damaging Het
Olfr1058 T A 2: 86,386,171 L82F probably damaging Het
Olfr770 A C 10: 129,133,980 probably null Het
Plec C A 15: 76,185,644 A991S unknown Het
Plekhg2 G A 7: 28,361,928 R817C probably damaging Het
Plrg1 T A 3: 83,058,682 L48H probably damaging Het
Prx A G 7: 27,507,972 E18G probably damaging Het
Ptprf T C 4: 118,212,748 Y1479C probably damaging Het
Rap1b A T 10: 117,817,452 Y159* probably null Het
Rbck1 T C 2: 152,324,292 E242G possibly damaging Het
Rxfp1 T C 3: 79,650,461 D570G probably benign Het
Slc35f5 G T 1: 125,584,538 L358F probably damaging Het
Smarcd2 A G 11: 106,265,761 W274R probably damaging Het
Ssu72 A G 4: 155,731,329 T77A probably benign Het
Tex33 T C 15: 78,386,316 D84G probably benign Het
Tomm40 G A 7: 19,702,904 T297I possibly damaging Het
Urb1 A T 16: 90,761,634 I1743N probably damaging Het
Utp20 G A 10: 88,753,006 R2434C probably damaging Het
Other mutations in Kif28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Kif28 APN 1 179702516 missense probably damaging 1.00
IGL00581:Kif28 APN 1 179739957 missense probably benign 0.14
R0348:Kif28 UTSW 1 179731253 missense probably damaging 1.00
R0388:Kif28 UTSW 1 179740089 missense possibly damaging 0.71
R0412:Kif28 UTSW 1 179702526 missense probably benign 0.01
R0788:Kif28 UTSW 1 179705223 unclassified probably benign
R0960:Kif28 UTSW 1 179695805 nonsense probably null
R1365:Kif28 UTSW 1 179739987 nonsense probably null
R1420:Kif28 UTSW 1 179702397 missense probably damaging 1.00
R1442:Kif28 UTSW 1 179705132 missense possibly damaging 0.73
R1507:Kif28 UTSW 1 179736006 missense probably damaging 1.00
R1818:Kif28 UTSW 1 179705754 missense possibly damaging 0.66
R1819:Kif28 UTSW 1 179705754 missense possibly damaging 0.66
R1903:Kif28 UTSW 1 179702523 missense possibly damaging 0.63
R2221:Kif28 UTSW 1 179733111 missense possibly damaging 0.80
R2358:Kif28 UTSW 1 179709459 missense probably damaging 1.00
R4916:Kif28 UTSW 1 179702520 missense probably benign 0.09
R4943:Kif28 UTSW 1 179713951 missense probably benign 0.02
R4967:Kif28 UTSW 1 179708442 missense probably damaging 1.00
R4974:Kif28 UTSW 1 179698644 missense probably damaging 0.98
R5152:Kif28 UTSW 1 179702538 missense probably damaging 1.00
R5382:Kif28 UTSW 1 179700282 missense probably damaging 1.00
R5649:Kif28 UTSW 1 179697771 splice site probably null
R5999:Kif28 UTSW 1 179695790 missense probably damaging 1.00
R6017:Kif28 UTSW 1 179699453 missense probably benign 0.24
R6180:Kif28 UTSW 1 179697772 splice site probably null
R6875:Kif28 UTSW 1 179735994 missense probably damaging 0.98
R7400:Kif28 UTSW 1 179700274 missense probably damaging 1.00
R7402:Kif28 UTSW 1 179740079 missense probably benign 0.00
R7589:Kif28 UTSW 1 179731400 missense probably benign 0.01
R7648:Kif28 UTSW 1 179709424 missense possibly damaging 0.89
R7815:Kif28 UTSW 1 179735983 missense probably damaging 1.00
R8030:Kif28 UTSW 1 179699064 missense probably benign 0.04
R8050:Kif28 UTSW 1 179709449 missense probably benign 0.00
R8088:Kif28 UTSW 1 179700354 missense probably damaging 1.00
R8781:Kif28 UTSW 1 179697916 missense probably benign 0.00
Z1176:Kif28 UTSW 1 179733134 missense probably benign 0.05
Z1177:Kif28 UTSW 1 179728219 missense not run
Predicted Primers PCR Primer
(F):5'- AACTTTCTGCATGCTGTACTCTGAC -3'
(R):5'- CTAATCCGAATCAGACCCAGGG -3'

Sequencing Primer
(F):5'- GCTGTACTCTGACATCGTGAAAGC -3'
(R):5'- TCCACTCCTGGAAGAGGG -3'
Posted On2019-10-17