Incidental Mutation 'R7530:Dpm2'
ID583244
Institutional Source Beutler Lab
Gene Symbol Dpm2
Ensembl Gene ENSMUSG00000026810
Gene Namedolichol-phosphate (beta-D) mannosyltransferase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7530 (G1)
Quality Score181.009
Status Validated
Chromosome2
Chromosomal Location32570858-32573579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32572301 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 33 (F33S)
Ref Sequence ENSEMBL: ENSMUSP00000028151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028151] [ENSMUST00000048375] [ENSMUST00000055304] [ENSMUST00000100188] [ENSMUST00000100190] [ENSMUST00000140592]
Predicted Effect probably damaging
Transcript: ENSMUST00000028151
AA Change: F33S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028151
Gene: ENSMUSG00000026810
AA Change: F33S

DomainStartEndE-ValueType
Pfam:DPM2 5 80 4.2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000048375
SMART Domains Protein: ENSMUSP00000044731
Gene: ENSMUSG00000039157

DomainStartEndE-ValueType
Pfam:NT-C2 6 152 4.8e-32 PFAM
low complexity region 177 194 N/A INTRINSIC
low complexity region 262 273 N/A INTRINSIC
low complexity region 283 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055304
SMART Domains Protein: ENSMUSP00000051282
Gene: ENSMUSG00000046854

DomainStartEndE-ValueType
Pfam:PIP5K 127 393 4.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100188
SMART Domains Protein: ENSMUSP00000097763
Gene: ENSMUSG00000046854

DomainStartEndE-ValueType
Pfam:PIP5K 165 358 4.3e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100190
Predicted Effect probably damaging
Transcript: ENSMUST00000140592
AA Change: F33S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124665
Gene: ENSMUSG00000026810
AA Change: F33S

DomainStartEndE-ValueType
Pfam:DPM2 5 68 3e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dolichol-phosphate mannose (Dol-P-Man) serves as a donor of mannosyl residues on the lumenal side of the endoplasmic reticulum (ER). Lack of Dol-P-Man results in defective surface expression of GPI-anchored proteins. Dol-P-Man is synthesized from GDP-mannose and dolichol-phosphate on the cytosolic side of the ER by the enzyme dolichyl-phosphate mannosyltransferase. The protein encoded by this gene is a hydrophobic protein that contains 2 predicted transmembrane domains and a putative ER localization signal near the C terminus. This protein associates with DPM1 in vivo and is required for the ER localization and stable expression of DPM1 and also enhances the binding of dolichol-phosphate to DPM1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,948,721 Y43* probably null Het
6430550D23Rik C T 2: 156,003,920 V6I probably benign Het
AI314180 A G 4: 58,815,317 M1322T probably damaging Het
Atp10a A G 7: 58,773,976 T230A probably benign Het
Atp5g2 A T 15: 102,667,748 M1K probably null Het
Atp8a1 A C 5: 67,745,628 L535R Het
Bsn A G 9: 108,111,956 I2199T probably damaging Het
Ccdc73 A G 2: 104,994,570 T155A Het
Cdc42bpg T G 19: 6,322,275 F1430L probably benign Het
Cdc42bpg G T 19: 6,322,276 V1431L probably benign Het
Chat A T 14: 32,408,958 Y575* probably null Het
Col6a4 A T 9: 106,068,390 C842S probably damaging Het
Coq2 T C 5: 100,674,142 S34G probably benign Het
Crybg1 C T 10: 43,999,073 A680T possibly damaging Het
Ctsr T A 13: 61,163,117 K38N probably damaging Het
Ext2 T A 2: 93,661,653 H564L probably benign Het
Fbxl2 G T 9: 113,989,173 H202N probably benign Het
Fra10ac1 A T 19: 38,215,905 Y74* probably null Het
Greb1 T A 12: 16,717,206 I332F probably benign Het
Ifnar2 A G 16: 91,404,313 S481G probably benign Het
Igkv9-123 G A 6: 67,954,397 P62S possibly damaging Het
Iqub T C 6: 24,450,623 Q659R probably benign Het
Kansl2 T C 15: 98,529,015 T242A probably benign Het
Kif28 C T 1: 179,708,480 G543D probably benign Het
Lsg1 A G 16: 30,582,601 S93P possibly damaging Het
Med23 T A 10: 24,905,953 C1052S probably benign Het
Mgam G T 6: 40,709,218 probably null Het
Mtmr4 C T 11: 87,611,876 R919W probably damaging Het
Muc5ac G T 7: 141,813,799 V2986L possibly damaging Het
Myo5b A G 18: 74,731,731 E1340G probably benign Het
Nkd2 T C 13: 73,846,959 D40G possibly damaging Het
Nudt5 T C 2: 5,864,368 L135S probably damaging Het
Oca2 A C 7: 56,331,972 D614A probably damaging Het
Olfr1 A G 11: 73,388,363 V221A possibly damaging Het
Olfr1058 T A 2: 86,386,171 L82F probably damaging Het
Olfr770 A C 10: 129,133,980 probably null Het
Plec C A 15: 76,185,644 A991S unknown Het
Plekhg2 G A 7: 28,361,928 R817C probably damaging Het
Plrg1 T A 3: 83,058,682 L48H probably damaging Het
Prx A G 7: 27,507,972 E18G probably damaging Het
Ptprf T C 4: 118,212,748 Y1479C probably damaging Het
Rap1b A T 10: 117,817,452 Y159* probably null Het
Rbck1 T C 2: 152,324,292 E242G possibly damaging Het
Rxfp1 T C 3: 79,650,461 D570G probably benign Het
Slc35f5 G T 1: 125,584,538 L358F probably damaging Het
Smarcd2 A G 11: 106,265,761 W274R probably damaging Het
Ssu72 A G 4: 155,731,329 T77A probably benign Het
Tex33 T C 15: 78,386,316 D84G probably benign Het
Tomm40 G A 7: 19,702,904 T297I possibly damaging Het
Urb1 A T 16: 90,761,634 I1743N probably damaging Het
Utp20 G A 10: 88,753,006 R2434C probably damaging Het
Other mutations in Dpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0537:Dpm2 UTSW 2 32572949 splice site probably null
R2373:Dpm2 UTSW 2 32572445 missense probably benign 0.00
R3877:Dpm2 UTSW 2 32572400 critical splice donor site probably null
R4682:Dpm2 UTSW 2 32572278 intron probably benign
R4872:Dpm2 UTSW 2 32571191 splice site probably benign
Predicted Primers PCR Primer
(F):5'- CAGAGACAATATGGTGGGTCTC -3'
(R):5'- CCCGTGGCCTTTAAGGAATAGG -3'

Sequencing Primer
(F):5'- CTTGTTATGATACATATCCACGCTTG -3'
(R):5'- CCTTTAAGGAATAGGAAAGCCCCG -3'
Posted On2019-10-17