Incidental Mutation 'R7530:Olfr1058'
ID583245
Institutional Source Beutler Lab
Gene Symbol Olfr1058
Ensembl Gene ENSMUSG00000075186
Gene Nameolfactory receptor 1058
SynonymsGA_x6K02T2Q125-47855818-47854868, MOR190-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R7530 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86384760-86388561 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86386171 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 82 (L82F)
Ref Sequence ENSEMBL: ENSMUSP00000151037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102631] [ENSMUST00000213998]
Predicted Effect probably damaging
Transcript: ENSMUST00000102631
AA Change: L82F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099691
Gene: ENSMUSG00000075186
AA Change: L82F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1e-49 PFAM
Pfam:7tm_1 41 290 1.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213998
AA Change: L82F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,948,721 Y43* probably null Het
6430550D23Rik C T 2: 156,003,920 V6I probably benign Het
AI314180 A G 4: 58,815,317 M1322T probably damaging Het
Atp10a A G 7: 58,773,976 T230A probably benign Het
Atp5g2 A T 15: 102,667,748 M1K probably null Het
Atp8a1 A C 5: 67,745,628 L535R Het
Bsn A G 9: 108,111,956 I2199T probably damaging Het
Ccdc73 A G 2: 104,994,570 T155A Het
Cdc42bpg T G 19: 6,322,275 F1430L probably benign Het
Cdc42bpg G T 19: 6,322,276 V1431L probably benign Het
Chat A T 14: 32,408,958 Y575* probably null Het
Col6a4 A T 9: 106,068,390 C842S probably damaging Het
Coq2 T C 5: 100,674,142 S34G probably benign Het
Crybg1 C T 10: 43,999,073 A680T possibly damaging Het
Ctsr T A 13: 61,163,117 K38N probably damaging Het
Dpm2 T C 2: 32,572,301 F33S probably damaging Het
Ext2 T A 2: 93,661,653 H564L probably benign Het
Fbxl2 G T 9: 113,989,173 H202N probably benign Het
Fra10ac1 A T 19: 38,215,905 Y74* probably null Het
Greb1 T A 12: 16,717,206 I332F probably benign Het
Ifnar2 A G 16: 91,404,313 S481G probably benign Het
Igkv9-123 G A 6: 67,954,397 P62S possibly damaging Het
Iqub T C 6: 24,450,623 Q659R probably benign Het
Kansl2 T C 15: 98,529,015 T242A probably benign Het
Kif28 C T 1: 179,708,480 G543D probably benign Het
Lsg1 A G 16: 30,582,601 S93P possibly damaging Het
Med23 T A 10: 24,905,953 C1052S probably benign Het
Mgam G T 6: 40,709,218 probably null Het
Mtmr4 C T 11: 87,611,876 R919W probably damaging Het
Muc5ac G T 7: 141,813,799 V2986L possibly damaging Het
Myo5b A G 18: 74,731,731 E1340G probably benign Het
Nkd2 T C 13: 73,846,959 D40G possibly damaging Het
Nudt5 T C 2: 5,864,368 L135S probably damaging Het
Oca2 A C 7: 56,331,972 D614A probably damaging Het
Olfr1 A G 11: 73,388,363 V221A possibly damaging Het
Olfr770 A C 10: 129,133,980 probably null Het
Plec C A 15: 76,185,644 A991S unknown Het
Plekhg2 G A 7: 28,361,928 R817C probably damaging Het
Plrg1 T A 3: 83,058,682 L48H probably damaging Het
Prx A G 7: 27,507,972 E18G probably damaging Het
Ptprf T C 4: 118,212,748 Y1479C probably damaging Het
Rap1b A T 10: 117,817,452 Y159* probably null Het
Rbck1 T C 2: 152,324,292 E242G possibly damaging Het
Rxfp1 T C 3: 79,650,461 D570G probably benign Het
Slc35f5 G T 1: 125,584,538 L358F probably damaging Het
Smarcd2 A G 11: 106,265,761 W274R probably damaging Het
Ssu72 A G 4: 155,731,329 T77A probably benign Het
Tex33 T C 15: 78,386,316 D84G probably benign Het
Tomm40 G A 7: 19,702,904 T297I possibly damaging Het
Urb1 A T 16: 90,761,634 I1743N probably damaging Het
Utp20 G A 10: 88,753,006 R2434C probably damaging Het
Other mutations in Olfr1058
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Olfr1058 APN 2 86386021 nonsense probably null
R0413:Olfr1058 UTSW 2 86385714 missense probably benign 0.02
R1315:Olfr1058 UTSW 2 86386174 missense possibly damaging 0.86
R1609:Olfr1058 UTSW 2 86385494 missense probably benign 0.07
R1951:Olfr1058 UTSW 2 86385511 missense probably benign 0.03
R2184:Olfr1058 UTSW 2 86386145 missense probably benign 0.05
R2351:Olfr1058 UTSW 2 86386127 missense probably damaging 0.99
R4067:Olfr1058 UTSW 2 86386087 nonsense probably null
R4706:Olfr1058 UTSW 2 86386388 missense probably benign 0.29
R5164:Olfr1058 UTSW 2 86385471 missense probably benign
R5224:Olfr1058 UTSW 2 86385849 missense possibly damaging 0.91
R5254:Olfr1058 UTSW 2 86386140 missense possibly damaging 0.65
R5424:Olfr1058 UTSW 2 86385840 nonsense probably null
R5907:Olfr1058 UTSW 2 86385874 missense probably damaging 0.97
R5980:Olfr1058 UTSW 2 86385797 nonsense probably null
R6348:Olfr1058 UTSW 2 86386169 missense probably benign
R6874:Olfr1058 UTSW 2 86385528 missense possibly damaging 0.95
R6897:Olfr1058 UTSW 2 86385680 missense possibly damaging 0.91
R7060:Olfr1058 UTSW 2 86386225 missense possibly damaging 0.95
R7516:Olfr1058 UTSW 2 86385984 missense probably benign 0.35
Z1088:Olfr1058 UTSW 2 86385756 missense probably benign 0.43
Z1088:Olfr1058 UTSW 2 86386179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAGCCACAATTGTACAGTAGAC -3'
(R):5'- AACTGCAGCCTCCATTATTTGTAC -3'

Sequencing Primer
(F):5'- GCACCAAGCATAGTCTTTTTGAC -3'
(R):5'- GCAGCCTCCATTATTTGTACTTTTC -3'
Posted On2019-10-17