Mutagenetix > Incidental Mutations

Incidental Mutation 'R7530:Rxfp1'

583250

Institutional Source

Beutler Lab

Gene Symbol

Rxfp1

Ensembl Gene

ENSMUSG00000034009

Gene Name

relaxin/insulin-like family peptide receptor 1

Synonyms

Lgr7, LOC381489

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.154) question?

Stock #

R7530 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79641611-79737880 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79650461 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 570 (D570G)

Ref Sequence

ENSEMBL: ENSMUSP00000077611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078527] [ENSMUST00000182491]

Predicted Effect

probably benign
Transcript: ENSMUST00000078527
AA Change: D570G

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000077611
Gene: ENSMUSG00000034009
AA Change: D570G

Domain	Start	End	E-Value	Type
LDLa	26	64	1.61e-8	SMART
LRRNT	101	130	9.51e-1	SMART
LRR	126	148	3.65e1	SMART
LRR	149	172	1.19e1	SMART
LRR_TYP	173	196	4.61e-5	SMART
LRR	197	220	1.86e0	SMART
LRR	221	244	1.86e2	SMART
LRR	246	269	2.03e1	SMART
LRR	270	293	1.76e2	SMART
LRR_TYP	294	317	4.24e-4	SMART
LRR	318	341	1.15e1	SMART
LRR	342	365	3.65e1	SMART
Pfam:7tm_1	422	681	2.8e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182491

SMART Domains

Protein: ENSMUSP00000138578
Gene: ENSMUSG00000034009

Domain	Start	End	E-Value	Type
LDLa	26	64	1.61e-8	SMART

Meta Mutation Damage Score

0.1481

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane receptor superfamily. The encoded protein plays a critical role in sperm motility, pregnancy and parturition as a receptor for the protein hormone relaxin. Decreased expression of this gene may play a role in endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced male fertility, particularly at younger ages and early generations. Impaired nipple development prevents nursing by females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4430402I18Rik	A	T	19: 28,948,721	Y43*	probably null	Het
6430550D23Rik	C	T	2: 156,003,920	V6I	probably benign	Het
AI314180	A	G	4: 58,815,317	M1322T	probably damaging	Het
Atp10a	A	G	7: 58,773,976	T230A	probably benign	Het
Atp5g2	A	T	15: 102,667,748	M1K	probably null	Het
Atp8a1	A	C	5: 67,745,628	L535R		Het
Bsn	A	G	9: 108,111,956	I2199T	probably damaging	Het
Ccdc73	A	G	2: 104,994,570	T155A		Het
Cdc42bpg	T	G	19: 6,322,275	F1430L	probably benign	Het
Cdc42bpg	G	T	19: 6,322,276	V1431L	probably benign	Het
Chat	A	T	14: 32,408,958	Y575*	probably null	Het
Col6a4	A	T	9: 106,068,390	C842S	probably damaging	Het
Coq2	T	C	5: 100,674,142	S34G	probably benign	Het
Crybg1	C	T	10: 43,999,073	A680T	possibly damaging	Het
Ctsr	T	A	13: 61,163,117	K38N	probably damaging	Het
Dpm2	T	C	2: 32,572,301	F33S	probably damaging	Het
Ext2	T	A	2: 93,661,653	H564L	probably benign	Het
Fbxl2	G	T	9: 113,989,173	H202N	probably benign	Het
Fra10ac1	A	T	19: 38,215,905	Y74*	probably null	Het
Greb1	T	A	12: 16,717,206	I332F	probably benign	Het
Ifnar2	A	G	16: 91,404,313	S481G	probably benign	Het
Igkv9-123	G	A	6: 67,954,397	P62S	possibly damaging	Het
Iqub	T	C	6: 24,450,623	Q659R	probably benign	Het
Kansl2	T	C	15: 98,529,015	T242A	probably benign	Het
Kif28	C	T	1: 179,708,480	G543D	probably benign	Het
Lsg1	A	G	16: 30,582,601	S93P	possibly damaging	Het
Med23	T	A	10: 24,905,953	C1052S	probably benign	Het
Mgam	G	T	6: 40,709,218		probably null	Het
Mtmr4	C	T	11: 87,611,876	R919W	probably damaging	Het
Muc5ac	G	T	7: 141,813,799	V2986L	possibly damaging	Het
Myo5b	A	G	18: 74,731,731	E1340G	probably benign	Het
Nkd2	T	C	13: 73,846,959	D40G	possibly damaging	Het
Nudt5	T	C	2: 5,864,368	L135S	probably damaging	Het
Oca2	A	C	7: 56,331,972	D614A	probably damaging	Het
Olfr1	A	G	11: 73,388,363	V221A	possibly damaging	Het
Olfr1058	T	A	2: 86,386,171	L82F	probably damaging	Het
Olfr770	A	C	10: 129,133,980		probably null	Het
Plec	C	A	15: 76,185,644	A991S	unknown	Het
Plekhg2	G	A	7: 28,361,928	R817C	probably damaging	Het
Plrg1	T	A	3: 83,058,682	L48H	probably damaging	Het
Prx	A	G	7: 27,507,972	E18G	probably damaging	Het
Ptprf	T	C	4: 118,212,748	Y1479C	probably damaging	Het
Rap1b	A	T	10: 117,817,452	Y159*	probably null	Het
Rbck1	T	C	2: 152,324,292	E242G	possibly damaging	Het
Slc35f5	G	T	1: 125,584,538	L358F	probably damaging	Het
Smarcd2	A	G	11: 106,265,761	W274R	probably damaging	Het
Ssu72	A	G	4: 155,731,329	T77A	probably benign	Het
Tex33	T	C	15: 78,386,316	D84G	probably benign	Het
Tomm40	G	A	7: 19,702,904	T297I	possibly damaging	Het
Urb1	A	T	16: 90,761,634	I1743N	probably damaging	Het
Utp20	G	A	10: 88,753,006	R2434C	probably damaging	Het

Other mutations in Rxfp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01758:Rxfp1	APN	3	79652216	missense	possibly damaging	0.81
IGL01962:Rxfp1	APN	3	79686868	missense	probably damaging	1.00
IGL01975:Rxfp1	APN	3	79660078	missense	possibly damaging	0.95
IGL01998:Rxfp1	APN	3	79660096	missense	probably benign	0.01
IGL02049:Rxfp1	APN	3	79650492	missense	probably damaging	0.99
IGL02153:Rxfp1	APN	3	79660120	missense	probably benign	0.00
IGL02490:Rxfp1	APN	3	79652167	critical splice donor site	probably null
IGL02526:Rxfp1	APN	3	79670846	critical splice donor site	probably null
IGL02985:Rxfp1	APN	3	79652226	missense	possibly damaging	0.65
IGL03252:Rxfp1	APN	3	79667683	missense	probably benign	0.29
juggler	UTSW	3	79650591	nonsense	probably null
R0123:Rxfp1	UTSW	3	79657476	missense	probably damaging	1.00
R0134:Rxfp1	UTSW	3	79657476	missense	probably damaging	1.00
R0230:Rxfp1	UTSW	3	79644975	missense	probably damaging	1.00
R0257:Rxfp1	UTSW	3	79682535	missense	possibly damaging	0.61
R0265:Rxfp1	UTSW	3	79667654	missense	probably benign	0.00
R0362:Rxfp1	UTSW	3	79737793	start codon destroyed	probably null	0.99
R0394:Rxfp1	UTSW	3	79652377	missense	possibly damaging	0.58
R0422:Rxfp1	UTSW	3	79650731	missense	probably benign	0.00
R0547:Rxfp1	UTSW	3	79705569	splice site	probably null
R0627:Rxfp1	UTSW	3	79648211	missense	probably benign	0.00
R0671:Rxfp1	UTSW	3	79663293	splice site	probably null
R1309:Rxfp1	UTSW	3	79663292	splice site	probably null
R1756:Rxfp1	UTSW	3	79670881	missense	probably benign	0.11
R1803:Rxfp1	UTSW	3	79737769	missense	probably benign
R2415:Rxfp1	UTSW	3	79663319	missense	probably benign	0.14
R2862:Rxfp1	UTSW	3	79682471	missense	possibly damaging	0.80
R4087:Rxfp1	UTSW	3	79644949	missense	probably damaging	0.99
R4091:Rxfp1	UTSW	3	79644761	missense	probably benign
R4250:Rxfp1	UTSW	3	79652272	missense	probably benign	0.41
R4335:Rxfp1	UTSW	3	79686798	critical splice donor site	probably null
R4447:Rxfp1	UTSW	3	79652127	intron	probably benign
R4607:Rxfp1	UTSW	3	79686889	missense	probably damaging	1.00
R4608:Rxfp1	UTSW	3	79686889	missense	probably damaging	1.00
R4676:Rxfp1	UTSW	3	79705668	missense	probably damaging	1.00
R4768:Rxfp1	UTSW	3	79686868	missense	probably damaging	1.00
R4812:Rxfp1	UTSW	3	79650582	missense	probably benign	0.00
R4909:Rxfp1	UTSW	3	79644802	missense	probably benign
R5059:Rxfp1	UTSW	3	79663312	missense	probably benign
R5131:Rxfp1	UTSW	3	79652164	splice site	probably null
R5641:Rxfp1	UTSW	3	79686892	missense	probably damaging	0.98
R5711:Rxfp1	UTSW	3	79678747	missense	probably damaging	1.00
R5757:Rxfp1	UTSW	3	79661320	missense	possibly damaging	0.89
R5856:Rxfp1	UTSW	3	79663313	missense	possibly damaging	0.76
R6296:Rxfp1	UTSW	3	79667848	missense	probably damaging	1.00
R6462:Rxfp1	UTSW	3	79648289	missense	probably benign	0.07
R6730:Rxfp1	UTSW	3	79650591	nonsense	probably null
R7059:Rxfp1	UTSW	3	79652269	missense	probably damaging	1.00
R7626:Rxfp1	UTSW	3	79648090	missense	probably damaging	0.99
R7684:Rxfp1	UTSW	3	79670907	missense	possibly damaging	0.66
Z1088:Rxfp1	UTSW	3	79705704	missense	probably damaging	1.00
Z1177:Rxfp1	UTSW	3	79652367	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CATGAGGAAATGTATTAAGGGTCAC -3'
(R):5'- TCTGACATTGGAAAAGTACATCTGC -3'

Sequencing Primer
(F):5'- TTAAGGGTCACAGCATTAGAAAGTTG -3'
(R):5'- TGGAAAAGTACATCTGCATTGTG -3'

Posted On

2019-10-17