Incidental Mutation 'R7530:Tomm40'
ID583259
Institutional Source Beutler Lab
Gene Symbol Tomm40
Ensembl Gene ENSMUSG00000002984
Gene Nametranslocase of outer mitochondrial membrane 40
SynonymsTom40
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7530 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location19701313-19715438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19702904 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 297 (T297I)
Ref Sequence ENSEMBL: ENSMUSP00000032555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003066] [ENSMUST00000032555] [ENSMUST00000093552] [ENSMUST00000172705] [ENSMUST00000172808] [ENSMUST00000172983] [ENSMUST00000173739] [ENSMUST00000174064] [ENSMUST00000174144] [ENSMUST00000174191] [ENSMUST00000174355] [ENSMUST00000174710]
Predicted Effect probably benign
Transcript: ENSMUST00000003066
SMART Domains Protein: ENSMUSP00000003066
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 291 3.8e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000032555
AA Change: T297I

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032555
Gene: ENSMUSG00000002984
AA Change: T297I

DomainStartEndE-ValueType
low complexity region 8 69 N/A INTRINSIC
Pfam:Porin_3 79 355 7.7e-85 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000093552
AA Change: T297I

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104090
Gene: ENSMUSG00000002984
AA Change: T297I

DomainStartEndE-ValueType
low complexity region 8 69 N/A INTRINSIC
Pfam:Porin_3 79 355 1.5e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172705
AA Change: T41I

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133975
Gene: ENSMUSG00000002984
AA Change: T41I

DomainStartEndE-ValueType
Pfam:Porin_3 1 61 3.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172808
SMART Domains Protein: ENSMUSP00000134558
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Apolipoprotein 61 146 8.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172983
SMART Domains Protein: ENSMUSP00000133359
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 232 1.3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173739
SMART Domains Protein: ENSMUSP00000133371
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 291 3.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174064
SMART Domains Protein: ENSMUSP00000133302
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 73 284 2e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174144
SMART Domains Protein: ENSMUSP00000134622
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 232 1.3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174191
SMART Domains Protein: ENSMUSP00000133447
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
PDB:1YA9|A 20 70 8e-31 PDB
SCOP:d1nfn__ 34 70 5e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174355
SMART Domains Protein: ENSMUSP00000134160
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Apolipoprotein 72 291 3.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174710
SMART Domains Protein: ENSMUSP00000134429
Gene: ENSMUSG00000002985

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
PDB:1YA9|A 20 70 8e-31 PDB
SCOP:d1nfn__ 34 70 5e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is localized in the outer membrane of the mitochondria. It is the channel-forming subunit of the translocase of the mitochondrial outer membrane (TOM) complex that is essential for import of protein precursors into mitochondria. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,948,721 Y43* probably null Het
6430550D23Rik C T 2: 156,003,920 V6I probably benign Het
AI314180 A G 4: 58,815,317 M1322T probably damaging Het
Atp10a A G 7: 58,773,976 T230A probably benign Het
Atp5g2 A T 15: 102,667,748 M1K probably null Het
Atp8a1 A C 5: 67,745,628 L535R Het
Bsn A G 9: 108,111,956 I2199T probably damaging Het
Ccdc73 A G 2: 104,994,570 T155A Het
Cdc42bpg T G 19: 6,322,275 F1430L probably benign Het
Cdc42bpg G T 19: 6,322,276 V1431L probably benign Het
Chat A T 14: 32,408,958 Y575* probably null Het
Col6a4 A T 9: 106,068,390 C842S probably damaging Het
Coq2 T C 5: 100,674,142 S34G probably benign Het
Crybg1 C T 10: 43,999,073 A680T possibly damaging Het
Ctsr T A 13: 61,163,117 K38N probably damaging Het
Dpm2 T C 2: 32,572,301 F33S probably damaging Het
Ext2 T A 2: 93,661,653 H564L probably benign Het
Fbxl2 G T 9: 113,989,173 H202N probably benign Het
Fra10ac1 A T 19: 38,215,905 Y74* probably null Het
Greb1 T A 12: 16,717,206 I332F probably benign Het
Ifnar2 A G 16: 91,404,313 S481G probably benign Het
Igkv9-123 G A 6: 67,954,397 P62S possibly damaging Het
Iqub T C 6: 24,450,623 Q659R probably benign Het
Kansl2 T C 15: 98,529,015 T242A probably benign Het
Kif28 C T 1: 179,708,480 G543D probably benign Het
Lsg1 A G 16: 30,582,601 S93P possibly damaging Het
Med23 T A 10: 24,905,953 C1052S probably benign Het
Mgam G T 6: 40,709,218 probably null Het
Mtmr4 C T 11: 87,611,876 R919W probably damaging Het
Muc5ac G T 7: 141,813,799 V2986L possibly damaging Het
Myo5b A G 18: 74,731,731 E1340G probably benign Het
Nkd2 T C 13: 73,846,959 D40G possibly damaging Het
Nudt5 T C 2: 5,864,368 L135S probably damaging Het
Oca2 A C 7: 56,331,972 D614A probably damaging Het
Olfr1058 T A 2: 86,386,171 L82F probably damaging Het
Plec C A 15: 76,185,644 A991S unknown Het
Plekhg2 G A 7: 28,361,928 R817C probably damaging Het
Plrg1 T A 3: 83,058,682 L48H probably damaging Het
Prx A G 7: 27,507,972 E18G probably damaging Het
Ptprf T C 4: 118,212,748 Y1479C probably damaging Het
Rap1b A T 10: 117,817,452 Y159* probably null Het
Rbck1 T C 2: 152,324,292 E242G possibly damaging Het
Rxfp1 T C 3: 79,650,461 D570G probably benign Het
Slc35f5 G T 1: 125,584,538 L358F probably damaging Het
Smarcd2 A G 11: 106,265,761 W274R probably damaging Het
Ssu72 A G 4: 155,731,329 T77A probably benign Het
Tex33 T C 15: 78,386,316 D84G probably benign Het
Urb1 A T 16: 90,761,634 I1743N probably damaging Het
Utp20 G A 10: 88,753,006 R2434C probably damaging Het
Other mutations in Tomm40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Tomm40 APN 7 19703363 missense probably benign 0.13
IGL01766:Tomm40 APN 7 19703082 missense possibly damaging 0.93
IGL02831:Tomm40 APN 7 19703089 missense probably damaging 1.00
IGL03178:Tomm40 APN 7 19701834 missense probably damaging 0.98
PIT4131001:Tomm40 UTSW 7 19703091 missense probably damaging 1.00
R0280:Tomm40 UTSW 7 19713751 missense probably damaging 1.00
R1842:Tomm40 UTSW 7 19713725 missense probably benign 0.41
R1913:Tomm40 UTSW 7 19710961 missense probably damaging 0.98
R3702:Tomm40 UTSW 7 19713673 missense possibly damaging 0.89
R4685:Tomm40 UTSW 7 19701836 missense probably benign 0.06
R5165:Tomm40 UTSW 7 19713667 critical splice donor site probably null
R5380:Tomm40 UTSW 7 19701750 missense probably benign 0.27
R6026:Tomm40 UTSW 7 19710964 missense probably benign 0.43
R6236:Tomm40 UTSW 7 19703356 missense probably benign 0.15
R6994:Tomm40 UTSW 7 19702906 missense probably damaging 0.98
R7206:Tomm40 UTSW 7 19710936 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGCCACCCAGAGTAATTTGG -3'
(R):5'- CATGCATGCGACGTATTACCAC -3'

Sequencing Primer
(F):5'- TAATTTGGAGCTGCACAGAGTCCC -3'
(R):5'- GACGTATTACCACAAAGCCAGTG -3'
Posted On2019-10-17