Incidental Mutation 'R7530:Oca2'
ID583262
Institutional Source Beutler Lab
Gene Symbol Oca2
Ensembl Gene ENSMUSG00000030450
Gene Nameoculocutaneous albinism II
SynonymsD7H15S12, p, D7H15S12
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R7530 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location56239760-56536518 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 56331972 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 614 (D614A)
Ref Sequence ENSEMBL: ENSMUSP00000032633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032633] [ENSMUST00000144739] [ENSMUST00000152693]
Predicted Effect probably damaging
Transcript: ENSMUST00000032633
AA Change: D614A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032633
Gene: ENSMUSG00000030450
AA Change: D614A

DomainStartEndE-ValueType
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ArsB 319 558 2e-10 PFAM
Pfam:CitMHS 337 770 2e-49 PFAM
Pfam:ArsB 562 827 8.9e-9 PFAM
Pfam:Na_sulph_symp 573 832 6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144739
Predicted Effect probably benign
Transcript: ENSMUST00000152693
SMART Domains Protein: ENSMUSP00000119099
Gene: ENSMUSG00000030450

DomainStartEndE-ValueType
transmembrane domain 171 193 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human homolog of the mouse p (pink-eyed dilution) gene. The encoded protein is believed to be an integral membrane protein involved in small molecule transport, specifically tyrosine, which is a precursor to melanin synthesis. It is involved in mammalian pigmentation, where it may control skin color variation and act as a determinant of brown or blue eye color. Mutations in this gene result in type 2 oculocutaneous albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mutations generally result in varying degrees of coat and eye pigment dilution. Specific alleles produce cleft palate, reproductive, endocrine or neurological disorders, and/or lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,948,721 Y43* probably null Het
6430550D23Rik C T 2: 156,003,920 V6I probably benign Het
AI314180 A G 4: 58,815,317 M1322T probably damaging Het
Atp10a A G 7: 58,773,976 T230A probably benign Het
Atp5g2 A T 15: 102,667,748 M1K probably null Het
Atp8a1 A C 5: 67,745,628 L535R Het
Bsn A G 9: 108,111,956 I2199T probably damaging Het
Ccdc73 A G 2: 104,994,570 T155A Het
Cdc42bpg T G 19: 6,322,275 F1430L probably benign Het
Cdc42bpg G T 19: 6,322,276 V1431L probably benign Het
Chat A T 14: 32,408,958 Y575* probably null Het
Col6a4 A T 9: 106,068,390 C842S probably damaging Het
Coq2 T C 5: 100,674,142 S34G probably benign Het
Crybg1 C T 10: 43,999,073 A680T possibly damaging Het
Ctsr T A 13: 61,163,117 K38N probably damaging Het
Dpm2 T C 2: 32,572,301 F33S probably damaging Het
Ext2 T A 2: 93,661,653 H564L probably benign Het
Fbxl2 G T 9: 113,989,173 H202N probably benign Het
Fra10ac1 A T 19: 38,215,905 Y74* probably null Het
Greb1 T A 12: 16,717,206 I332F probably benign Het
Ifnar2 A G 16: 91,404,313 S481G probably benign Het
Igkv9-123 G A 6: 67,954,397 P62S possibly damaging Het
Iqub T C 6: 24,450,623 Q659R probably benign Het
Kansl2 T C 15: 98,529,015 T242A probably benign Het
Kif28 C T 1: 179,708,480 G543D probably benign Het
Lsg1 A G 16: 30,582,601 S93P possibly damaging Het
Med23 T A 10: 24,905,953 C1052S probably benign Het
Mgam G T 6: 40,709,218 probably null Het
Mtmr4 C T 11: 87,611,876 R919W probably damaging Het
Muc5ac G T 7: 141,813,799 V2986L possibly damaging Het
Myo5b A G 18: 74,731,731 E1340G probably benign Het
Nkd2 T C 13: 73,846,959 D40G possibly damaging Het
Nudt5 T C 2: 5,864,368 L135S probably damaging Het
Olfr1 A G 11: 73,388,363 V221A possibly damaging Het
Olfr1058 T A 2: 86,386,171 L82F probably damaging Het
Olfr770 A C 10: 129,133,980 probably null Het
Plec C A 15: 76,185,644 A991S unknown Het
Plekhg2 G A 7: 28,361,928 R817C probably damaging Het
Plrg1 T A 3: 83,058,682 L48H probably damaging Het
Prx A G 7: 27,507,972 E18G probably damaging Het
Ptprf T C 4: 118,212,748 Y1479C probably damaging Het
Rap1b A T 10: 117,817,452 Y159* probably null Het
Rbck1 T C 2: 152,324,292 E242G possibly damaging Het
Rxfp1 T C 3: 79,650,461 D570G probably benign Het
Slc35f5 G T 1: 125,584,538 L358F probably damaging Het
Smarcd2 A G 11: 106,265,761 W274R probably damaging Het
Ssu72 A G 4: 155,731,329 T77A probably benign Het
Tex33 T C 15: 78,386,316 D84G probably benign Het
Tomm40 G A 7: 19,702,904 T297I possibly damaging Het
Urb1 A T 16: 90,761,634 I1743N probably damaging Het
Utp20 G A 10: 88,753,006 R2434C probably damaging Het
Other mutations in Oca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Oca2 APN 7 56280846 missense probably damaging 0.99
IGL01022:Oca2 APN 7 56324756 missense probably damaging 1.00
IGL01666:Oca2 APN 7 56314811 splice site probably null
IGL02157:Oca2 APN 7 56324797 splice site probably null
IGL02213:Oca2 APN 7 56321484 splice site probably benign
IGL02314:Oca2 APN 7 56357151 missense probably benign 0.00
IGL03083:Oca2 APN 7 56295484 missense probably benign 0.28
IGL03356:Oca2 APN 7 56535968 missense probably benign 0.01
charbon UTSW 7 56316405 missense probably damaging 1.00
cotton UTSW 7 56535968 missense probably benign 0.00
Dirk UTSW 7 56535968 missense probably benign 0.00
draco1 UTSW 7 56423352 missense probably benign 0.00
faded UTSW 7 56324661 missense probably benign 0.19
hardy UTSW 7 56295460 missense probably damaging 1.00
narwhal UTSW 7 56295498 nonsense probably null
quicksilver UTSW 7 56324661 missense probably benign 0.19
renesmee UTSW 7 56535968 missense probably benign 0.00
snowflake UTSW 7 56324680 missense probably damaging 1.00
whitemouse UTSW 7 56414431 missense probably damaging 1.00
R0440:Oca2 UTSW 7 56423352 missense probably benign 0.00
R1067:Oca2 UTSW 7 56316393 missense probably damaging 1.00
R1349:Oca2 UTSW 7 56535968 missense probably benign 0.00
R1372:Oca2 UTSW 7 56535968 missense probably benign 0.00
R1457:Oca2 UTSW 7 56321521 missense probably damaging 1.00
R1737:Oca2 UTSW 7 56328785 missense probably damaging 1.00
R1802:Oca2 UTSW 7 56254980 missense possibly damaging 0.96
R1957:Oca2 UTSW 7 56321498 missense possibly damaging 0.82
R1966:Oca2 UTSW 7 56414467 missense probably damaging 0.99
R2082:Oca2 UTSW 7 56297137 missense probably benign 0.01
R2229:Oca2 UTSW 7 56357155 missense probably benign 0.11
R4120:Oca2 UTSW 7 56254882 missense probably damaging 1.00
R4192:Oca2 UTSW 7 56297249 missense probably damaging 1.00
R4405:Oca2 UTSW 7 56414434 missense possibly damaging 0.63
R4654:Oca2 UTSW 7 56328812 missense probably benign 0.44
R4701:Oca2 UTSW 7 56255002 missense probably benign 0.00
R4887:Oca2 UTSW 7 56330358 nonsense probably null
R5053:Oca2 UTSW 7 56323580 missense probably benign 0.02
R5215:Oca2 UTSW 7 56295498 nonsense probably null
R5430:Oca2 UTSW 7 56295460 missense probably damaging 1.00
R5677:Oca2 UTSW 7 56414462 missense probably damaging 1.00
R6416:Oca2 UTSW 7 56328767 missense probably benign 0.44
R6645:Oca2 UTSW 7 56314774 missense probably benign 0.21
R7257:Oca2 UTSW 7 56279538 intron probably benign
R7409:Oca2 UTSW 7 56414397 missense probably benign 0.00
R7820:Oca2 UTSW 7 56331965 missense probably damaging 1.00
Z1088:Oca2 UTSW 7 56330375 missense probably null 0.83
Predicted Primers PCR Primer
(F):5'- ACTCATTACCTTGTGACTCTGGG -3'
(R):5'- CCTTTGGTACAGTTATCATCTGGG -3'

Sequencing Primer
(F):5'- ACTGCTGCATATGTACCAGG -3'
(R):5'- TGGTACAGTTATCATCTGGGAATAG -3'
Posted On2019-10-17