Mutagenetix > Incidental Mutations

Incidental Mutation 'R7530:Oca2'

583262

Institutional Source

Beutler Lab

Gene Symbol

Oca2

Ensembl Gene

ENSMUSG00000030450

Gene Name

oculocutaneous albinism II

Synonyms

D7H15S12, p, D7H15S12

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.268) question?

Stock #

R7530 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

56239760-56536518 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 56331972 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 614 (D614A)

Ref Sequence

ENSEMBL: ENSMUSP00000032633 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032633] [ENSMUST00000144739] [ENSMUST00000152693]

Predicted Effect

probably damaging
Transcript: ENSMUST00000032633
AA Change: D614A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000032633
Gene: ENSMUSG00000030450
AA Change: D614A

Domain	Start	End	E-Value	Type
transmembrane domain	171	193	N/A	INTRINSIC
Pfam:ArsB	319	558	2e-10	PFAM
Pfam:CitMHS	337	770	2e-49	PFAM
Pfam:ArsB	562	827	8.9e-9	PFAM
Pfam:Na_sulph_symp	573	832	6e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000144739

Predicted Effect

probably benign
Transcript: ENSMUST00000152693

SMART Domains

Protein: ENSMUSP00000119099
Gene: ENSMUSG00000030450

Domain	Start	End	E-Value	Type
transmembrane domain	171	193	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human homolog of the mouse p (pink-eyed dilution) gene. The encoded protein is believed to be an integral membrane protein involved in small molecule transport, specifically tyrosine, which is a precursor to melanin synthesis. It is involved in mammalian pigmentation, where it may control skin color variation and act as a determinant of brown or blue eye color. Mutations in this gene result in type 2 oculocutaneous albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mutations generally result in varying degrees of coat and eye pigment dilution. Specific alleles produce cleft palate, reproductive, endocrine or neurological disorders, and/or lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4430402I18Rik	A	T	19: 28,948,721	Y43*	probably null	Het
6430550D23Rik	C	T	2: 156,003,920	V6I	probably benign	Het
AI314180	A	G	4: 58,815,317	M1322T	probably damaging	Het
Atp10a	A	G	7: 58,773,976	T230A	probably benign	Het
Atp5g2	A	T	15: 102,667,748	M1K	probably null	Het
Atp8a1	A	C	5: 67,745,628	L535R		Het
Bsn	A	G	9: 108,111,956	I2199T	probably damaging	Het
Ccdc73	A	G	2: 104,994,570	T155A		Het
Cdc42bpg	T	G	19: 6,322,275	F1430L	probably benign	Het
Cdc42bpg	G	T	19: 6,322,276	V1431L	probably benign	Het
Chat	A	T	14: 32,408,958	Y575*	probably null	Het
Col6a4	A	T	9: 106,068,390	C842S	probably damaging	Het
Coq2	T	C	5: 100,674,142	S34G	probably benign	Het
Crybg1	C	T	10: 43,999,073	A680T	possibly damaging	Het
Ctsr	T	A	13: 61,163,117	K38N	probably damaging	Het
Dpm2	T	C	2: 32,572,301	F33S	probably damaging	Het
Ext2	T	A	2: 93,661,653	H564L	probably benign	Het
Fbxl2	G	T	9: 113,989,173	H202N	probably benign	Het
Fra10ac1	A	T	19: 38,215,905	Y74*	probably null	Het
Greb1	T	A	12: 16,717,206	I332F	probably benign	Het
Ifnar2	A	G	16: 91,404,313	S481G	probably benign	Het
Igkv9-123	G	A	6: 67,954,397	P62S	possibly damaging	Het
Iqub	T	C	6: 24,450,623	Q659R	probably benign	Het
Kansl2	T	C	15: 98,529,015	T242A	probably benign	Het
Kif28	C	T	1: 179,708,480	G543D	probably benign	Het
Lsg1	A	G	16: 30,582,601	S93P	possibly damaging	Het
Med23	T	A	10: 24,905,953	C1052S	probably benign	Het
Mgam	G	T	6: 40,709,218		probably null	Het
Mtmr4	C	T	11: 87,611,876	R919W	probably damaging	Het
Muc5ac	G	T	7: 141,813,799	V2986L	possibly damaging	Het
Myo5b	A	G	18: 74,731,731	E1340G	probably benign	Het
Nkd2	T	C	13: 73,846,959	D40G	possibly damaging	Het
Nudt5	T	C	2: 5,864,368	L135S	probably damaging	Het
Olfr1	A	G	11: 73,388,363	V221A	possibly damaging	Het
Olfr1058	T	A	2: 86,386,171	L82F	probably damaging	Het
Olfr770	A	C	10: 129,133,980		probably null	Het
Plec	C	A	15: 76,185,644	A991S	unknown	Het
Plekhg2	G	A	7: 28,361,928	R817C	probably damaging	Het
Plrg1	T	A	3: 83,058,682	L48H	probably damaging	Het
Prx	A	G	7: 27,507,972	E18G	probably damaging	Het
Ptprf	T	C	4: 118,212,748	Y1479C	probably damaging	Het
Rap1b	A	T	10: 117,817,452	Y159*	probably null	Het
Rbck1	T	C	2: 152,324,292	E242G	possibly damaging	Het
Rxfp1	T	C	3: 79,650,461	D570G	probably benign	Het
Slc35f5	G	T	1: 125,584,538	L358F	probably damaging	Het
Smarcd2	A	G	11: 106,265,761	W274R	probably damaging	Het
Ssu72	A	G	4: 155,731,329	T77A	probably benign	Het
Tex33	T	C	15: 78,386,316	D84G	probably benign	Het
Tomm40	G	A	7: 19,702,904	T297I	possibly damaging	Het
Urb1	A	T	16: 90,761,634	I1743N	probably damaging	Het
Utp20	G	A	10: 88,753,006	R2434C	probably damaging	Het

Other mutations in Oca2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Oca2	APN	7	56280846	missense	probably damaging	0.99
IGL01022:Oca2	APN	7	56324756	missense	probably damaging	1.00
IGL01666:Oca2	APN	7	56314811	splice site	probably null
IGL02157:Oca2	APN	7	56324797	splice site	probably null
IGL02213:Oca2	APN	7	56321484	splice site	probably benign
IGL02314:Oca2	APN	7	56357151	missense	probably benign	0.00
IGL03083:Oca2	APN	7	56295484	missense	probably benign	0.28
IGL03356:Oca2	APN	7	56535968	missense	probably benign	0.01
charbon	UTSW	7	56316405	missense	probably damaging	1.00
cotton	UTSW	7	56535968	missense	probably benign	0.00
Dirk	UTSW	7	56535968	missense	probably benign	0.00
draco1	UTSW	7	56423352	missense	probably benign	0.00
faded	UTSW	7	56324661	missense	probably benign	0.19
hardy	UTSW	7	56295460	missense	probably damaging	1.00
narwhal	UTSW	7	56295498	nonsense	probably null
quicksilver	UTSW	7	56324661	missense	probably benign	0.19
renesmee	UTSW	7	56535968	missense	probably benign	0.00
snowflake	UTSW	7	56324680	missense	probably damaging	1.00
whitemouse	UTSW	7	56414431	missense	probably damaging	1.00
R0440:Oca2	UTSW	7	56423352	missense	probably benign	0.00
R1067:Oca2	UTSW	7	56316393	missense	probably damaging	1.00
R1349:Oca2	UTSW	7	56535968	missense	probably benign	0.00
R1372:Oca2	UTSW	7	56535968	missense	probably benign	0.00
R1457:Oca2	UTSW	7	56321521	missense	probably damaging	1.00
R1737:Oca2	UTSW	7	56328785	missense	probably damaging	1.00
R1802:Oca2	UTSW	7	56254980	missense	possibly damaging	0.96
R1957:Oca2	UTSW	7	56321498	missense	possibly damaging	0.82
R1966:Oca2	UTSW	7	56414467	missense	probably damaging	0.99
R2082:Oca2	UTSW	7	56297137	missense	probably benign	0.01
R2229:Oca2	UTSW	7	56357155	missense	probably benign	0.11
R4120:Oca2	UTSW	7	56254882	missense	probably damaging	1.00
R4192:Oca2	UTSW	7	56297249	missense	probably damaging	1.00
R4405:Oca2	UTSW	7	56414434	missense	possibly damaging	0.63
R4654:Oca2	UTSW	7	56328812	missense	probably benign	0.44
R4701:Oca2	UTSW	7	56255002	missense	probably benign	0.00
R4887:Oca2	UTSW	7	56330358	nonsense	probably null
R5053:Oca2	UTSW	7	56323580	missense	probably benign	0.02
R5215:Oca2	UTSW	7	56295498	nonsense	probably null
R5430:Oca2	UTSW	7	56295460	missense	probably damaging	1.00
R5677:Oca2	UTSW	7	56414462	missense	probably damaging	1.00
R6416:Oca2	UTSW	7	56328767	missense	probably benign	0.44
R6645:Oca2	UTSW	7	56314774	missense	probably benign	0.21
R7257:Oca2	UTSW	7	56279538	intron	probably benign
R7409:Oca2	UTSW	7	56414397	missense	probably benign	0.00
R7820:Oca2	UTSW	7	56331965	missense	probably damaging	1.00
Z1088:Oca2	UTSW	7	56330375	missense	probably null	0.83

Predicted Primers

PCR Primer
(F):5'- ACTCATTACCTTGTGACTCTGGG -3'
(R):5'- CCTTTGGTACAGTTATCATCTGGG -3'

Sequencing Primer
(F):5'- ACTGCTGCATATGTACCAGG -3'
(R):5'- TGGTACAGTTATCATCTGGGAATAG -3'

Posted On

2019-10-17