Incidental Mutation 'R7530:Rap1b'
ID583271
Institutional Source Beutler Lab
Gene Symbol Rap1b
Ensembl Gene ENSMUSG00000052681
Gene NameRAS related protein 1b
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.472) question?
Stock #R7530 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location117813871-117846035 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 117817452 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 159 (Y159*)
Ref Sequence ENSEMBL: ENSMUSP00000066238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064667] [ENSMUST00000220214]
Predicted Effect probably null
Transcript: ENSMUST00000064667
AA Change: Y159*
SMART Domains Protein: ENSMUSP00000066238
Gene: ENSMUSG00000052681
AA Change: Y159*

DomainStartEndE-ValueType
RAS 1 168 2.4e-122 SMART
Predicted Effect probably null
Transcript: ENSMUST00000220214
AA Change: Y28*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RAS-like small GTP-binding protein superfamily. Members of this family regulate multiple cellular processes including cell adhesion and growth and differentiation. This protein localizes to cellular membranes and has been shown to regulate integrin-mediated cell signaling. This protein also plays a role in regulating outside-in signaling in platelets. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 5, 6 and 9. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display partial embryonic and perinatal lethality, abdominal, cranial, and hepatic bleeding in mice that die in utero, reduced platelet aggregation, and decreased thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,948,721 Y43* probably null Het
6430550D23Rik C T 2: 156,003,920 V6I probably benign Het
AI314180 A G 4: 58,815,317 M1322T probably damaging Het
Atp10a A G 7: 58,773,976 T230A probably benign Het
Atp5g2 A T 15: 102,667,748 M1K probably null Het
Atp8a1 A C 5: 67,745,628 L535R Het
Bsn A G 9: 108,111,956 I2199T probably damaging Het
Ccdc73 A G 2: 104,994,570 T155A Het
Cdc42bpg T G 19: 6,322,275 F1430L probably benign Het
Cdc42bpg G T 19: 6,322,276 V1431L probably benign Het
Chat A T 14: 32,408,958 Y575* probably null Het
Col6a4 A T 9: 106,068,390 C842S probably damaging Het
Coq2 T C 5: 100,674,142 S34G probably benign Het
Crybg1 C T 10: 43,999,073 A680T possibly damaging Het
Ctsr T A 13: 61,163,117 K38N probably damaging Het
Dpm2 T C 2: 32,572,301 F33S probably damaging Het
Ext2 T A 2: 93,661,653 H564L probably benign Het
Fbxl2 G T 9: 113,989,173 H202N probably benign Het
Fra10ac1 A T 19: 38,215,905 Y74* probably null Het
Greb1 T A 12: 16,717,206 I332F probably benign Het
Ifnar2 A G 16: 91,404,313 S481G probably benign Het
Igkv9-123 G A 6: 67,954,397 P62S possibly damaging Het
Iqub T C 6: 24,450,623 Q659R probably benign Het
Kansl2 T C 15: 98,529,015 T242A probably benign Het
Kif28 C T 1: 179,708,480 G543D probably benign Het
Lsg1 A G 16: 30,582,601 S93P possibly damaging Het
Med23 T A 10: 24,905,953 C1052S probably benign Het
Mgam G T 6: 40,709,218 probably null Het
Mtmr4 C T 11: 87,611,876 R919W probably damaging Het
Muc5ac G T 7: 141,813,799 V2986L possibly damaging Het
Myo5b A G 18: 74,731,731 E1340G probably benign Het
Nkd2 T C 13: 73,846,959 D40G possibly damaging Het
Nudt5 T C 2: 5,864,368 L135S probably damaging Het
Oca2 A C 7: 56,331,972 D614A probably damaging Het
Olfr1 A G 11: 73,388,363 V221A possibly damaging Het
Olfr1058 T A 2: 86,386,171 L82F probably damaging Het
Olfr770 A C 10: 129,133,980 probably null Het
Plec C A 15: 76,185,644 A991S unknown Het
Plekhg2 G A 7: 28,361,928 R817C probably damaging Het
Plrg1 T A 3: 83,058,682 L48H probably damaging Het
Prx A G 7: 27,507,972 E18G probably damaging Het
Ptprf T C 4: 118,212,748 Y1479C probably damaging Het
Rbck1 T C 2: 152,324,292 E242G possibly damaging Het
Rxfp1 T C 3: 79,650,461 D570G probably benign Het
Slc35f5 G T 1: 125,584,538 L358F probably damaging Het
Smarcd2 A G 11: 106,265,761 W274R probably damaging Het
Ssu72 A G 4: 155,731,329 T77A probably benign Het
Tex33 T C 15: 78,386,316 D84G probably benign Het
Tomm40 G A 7: 19,702,904 T297I possibly damaging Het
Urb1 A T 16: 90,761,634 I1743N probably damaging Het
Utp20 G A 10: 88,753,006 R2434C probably damaging Het
Other mutations in Rap1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01932:Rap1b APN 10 117822860 missense probably damaging 1.00
IGL02539:Rap1b APN 10 117822804 missense possibly damaging 0.82
IGL03286:Rap1b APN 10 117818575 nonsense probably null
R0591:Rap1b UTSW 10 117818617 unclassified probably benign
R1939:Rap1b UTSW 10 117818586 missense probably damaging 1.00
R2509:Rap1b UTSW 10 117818539 missense probably damaging 0.98
R2902:Rap1b UTSW 10 117824602 missense probably damaging 1.00
R4825:Rap1b UTSW 10 117818582 missense probably benign 0.04
R5131:Rap1b UTSW 10 117824611 missense probably damaging 0.96
R6084:Rap1b UTSW 10 117824611 missense probably damaging 0.96
R6186:Rap1b UTSW 10 117820552 missense probably damaging 1.00
R6737:Rap1b UTSW 10 117822808 missense probably damaging 0.97
R7026:Rap1b UTSW 10 117818479 missense probably benign 0.01
R8069:Rap1b UTSW 10 117821609
Predicted Primers PCR Primer
(F):5'- GCCCCTCACTTCTGATGAATATG -3'
(R):5'- AAACGTGGAGATTCCTTTACAGC -3'

Sequencing Primer
(F):5'- TGAACATGTAATCTGAGTCCCCAGG -3'
(R):5'- CCTTTACAGCTGTGGAAATTGCCAG -3'
Posted On2019-10-17