Incidental Mutation 'R7530:Ctsr'
ID583275
Institutional Source Beutler Lab
Gene Symbol Ctsr
Ensembl Gene ENSMUSG00000055679
Gene Namecathepsin R
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R7530 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location61159204-61164256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61163117 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 38 (K38N)
Ref Sequence ENSEMBL: ENSMUSP00000021889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021889]
Predicted Effect probably damaging
Transcript: ENSMUST00000021889
AA Change: K38N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021889
Gene: ENSMUSG00000055679
AA Change: K38N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Inhibitor_I29 29 88 1.68e-21 SMART
Pept_C1 115 333 1.59e-111 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,948,721 Y43* probably null Het
6430550D23Rik C T 2: 156,003,920 V6I probably benign Het
AI314180 A G 4: 58,815,317 M1322T probably damaging Het
Atp10a A G 7: 58,773,976 T230A probably benign Het
Atp5g2 A T 15: 102,667,748 M1K probably null Het
Atp8a1 A C 5: 67,745,628 L535R Het
Bsn A G 9: 108,111,956 I2199T probably damaging Het
Ccdc73 A G 2: 104,994,570 T155A Het
Cdc42bpg T G 19: 6,322,275 F1430L probably benign Het
Cdc42bpg G T 19: 6,322,276 V1431L probably benign Het
Chat A T 14: 32,408,958 Y575* probably null Het
Col6a4 A T 9: 106,068,390 C842S probably damaging Het
Coq2 T C 5: 100,674,142 S34G probably benign Het
Crybg1 C T 10: 43,999,073 A680T possibly damaging Het
Dpm2 T C 2: 32,572,301 F33S probably damaging Het
Ext2 T A 2: 93,661,653 H564L probably benign Het
Fbxl2 G T 9: 113,989,173 H202N probably benign Het
Fra10ac1 A T 19: 38,215,905 Y74* probably null Het
Greb1 T A 12: 16,717,206 I332F probably benign Het
Ifnar2 A G 16: 91,404,313 S481G probably benign Het
Igkv9-123 G A 6: 67,954,397 P62S possibly damaging Het
Iqub T C 6: 24,450,623 Q659R probably benign Het
Kansl2 T C 15: 98,529,015 T242A probably benign Het
Kif28 C T 1: 179,708,480 G543D probably benign Het
Lsg1 A G 16: 30,582,601 S93P possibly damaging Het
Med23 T A 10: 24,905,953 C1052S probably benign Het
Mgam G T 6: 40,709,218 probably null Het
Mtmr4 C T 11: 87,611,876 R919W probably damaging Het
Muc5ac G T 7: 141,813,799 V2986L possibly damaging Het
Myo5b A G 18: 74,731,731 E1340G probably benign Het
Nkd2 T C 13: 73,846,959 D40G possibly damaging Het
Nudt5 T C 2: 5,864,368 L135S probably damaging Het
Oca2 A C 7: 56,331,972 D614A probably damaging Het
Olfr1058 T A 2: 86,386,171 L82F probably damaging Het
Plec C A 15: 76,185,644 A991S unknown Het
Plekhg2 G A 7: 28,361,928 R817C probably damaging Het
Plrg1 T A 3: 83,058,682 L48H probably damaging Het
Prx A G 7: 27,507,972 E18G probably damaging Het
Ptprf T C 4: 118,212,748 Y1479C probably damaging Het
Rap1b A T 10: 117,817,452 Y159* probably null Het
Rbck1 T C 2: 152,324,292 E242G possibly damaging Het
Rxfp1 T C 3: 79,650,461 D570G probably benign Het
Slc35f5 G T 1: 125,584,538 L358F probably damaging Het
Smarcd2 A G 11: 106,265,761 W274R probably damaging Het
Ssu72 A G 4: 155,731,329 T77A probably benign Het
Tex33 T C 15: 78,386,316 D84G probably benign Het
Tomm40 G A 7: 19,702,904 T297I possibly damaging Het
Urb1 A T 16: 90,761,634 I1743N probably damaging Het
Utp20 G A 10: 88,753,006 R2434C probably damaging Het
Other mutations in Ctsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Ctsr APN 13 61162742 missense probably damaging 1.00
IGL01327:Ctsr APN 13 61162675 splice site probably benign
IGL02169:Ctsr APN 13 61163240 splice site probably benign
IGL02516:Ctsr APN 13 61163178 missense probably benign
IGL02739:Ctsr APN 13 61161844 missense probably benign 0.01
PIT4687001:Ctsr UTSW 13 61160532 missense possibly damaging 0.52
R0180:Ctsr UTSW 13 61162745 missense probably damaging 1.00
R1938:Ctsr UTSW 13 61162445 missense probably benign 0.00
R2362:Ctsr UTSW 13 61162796 missense probably damaging 1.00
R3856:Ctsr UTSW 13 61161936 missense possibly damaging 0.75
R4125:Ctsr UTSW 13 61161845 missense probably benign 0.17
R4135:Ctsr UTSW 13 61161270 missense probably benign 0.15
R4903:Ctsr UTSW 13 61163131 missense probably benign 0.01
R5551:Ctsr UTSW 13 61159543 missense probably damaging 1.00
R5705:Ctsr UTSW 13 61161264 missense probably damaging 1.00
R5721:Ctsr UTSW 13 61161853 missense possibly damaging 0.84
R6132:Ctsr UTSW 13 61161768 critical splice donor site probably null
R6196:Ctsr UTSW 13 61160531 missense probably benign 0.09
R6719:Ctsr UTSW 13 61160451 missense possibly damaging 0.60
R7698:Ctsr UTSW 13 61162567 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCTGTTCTACCAGTGGTTG -3'
(R):5'- AGTACACCATGGGCTCTTCAG -3'

Sequencing Primer
(F):5'- ACCAGTGGTTGTGATTAGATAAGTTC -3'
(R):5'- TGAATCTCATAACCACCAGTGAATG -3'
Posted On2019-10-17