Incidental Mutation 'R7530:Chat'
ID583277
Institutional Source Beutler Lab
Gene Symbol Chat
Ensembl Gene ENSMUSG00000021919
Gene Namecholine acetyltransferase
SynonymsB230380D24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.834) question?
Stock #R7530 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location32408203-32465989 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 32408958 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 575 (Y575*)
Ref Sequence ENSEMBL: ENSMUSP00000070865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070125]
Predicted Effect probably null
Transcript: ENSMUST00000070125
AA Change: Y575*
SMART Domains Protein: ENSMUSP00000070865
Gene: ENSMUSG00000021919
AA Change: Y575*

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 24 612 5.5e-190 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which catalyzes the biosynthesis of the neurotransmitter acetylcholine. This gene product is a characteristic feature of cholinergic neurons, and changes in these neurons may explain some of the symptoms of Alzheimer's disease. Polymorphisms in this gene have been associated with Alzheimer's disease and mild cognitive impairment. Mutations in this gene are associated with congenital myasthenic syndrome associated with episodic apnea. Multiple transcript variants encoding different isoforms have been found for this gene, and some of these variants have been shown to encode more than one isoform. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutation of this gene results in hyperinnervation of motor neurons, abnormal morphology and patterning of neuromuscular synapses, and perinatal lethality. Mutant fetuses at E18.5 exhibit a hunched position, reduced body length, and carpoptosis(drop wrist). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,948,721 Y43* probably null Het
6430550D23Rik C T 2: 156,003,920 V6I probably benign Het
AI314180 A G 4: 58,815,317 M1322T probably damaging Het
Atp10a A G 7: 58,773,976 T230A probably benign Het
Atp5g2 A T 15: 102,667,748 M1K probably null Het
Atp8a1 A C 5: 67,745,628 L535R Het
Bsn A G 9: 108,111,956 I2199T probably damaging Het
Ccdc73 A G 2: 104,994,570 T155A Het
Cdc42bpg T G 19: 6,322,275 F1430L probably benign Het
Cdc42bpg G T 19: 6,322,276 V1431L probably benign Het
Col6a4 A T 9: 106,068,390 C842S probably damaging Het
Coq2 T C 5: 100,674,142 S34G probably benign Het
Crybg1 C T 10: 43,999,073 A680T possibly damaging Het
Ctsr T A 13: 61,163,117 K38N probably damaging Het
Dpm2 T C 2: 32,572,301 F33S probably damaging Het
Ext2 T A 2: 93,661,653 H564L probably benign Het
Fbxl2 G T 9: 113,989,173 H202N probably benign Het
Fra10ac1 A T 19: 38,215,905 Y74* probably null Het
Greb1 T A 12: 16,717,206 I332F probably benign Het
Ifnar2 A G 16: 91,404,313 S481G probably benign Het
Igkv9-123 G A 6: 67,954,397 P62S possibly damaging Het
Iqub T C 6: 24,450,623 Q659R probably benign Het
Kansl2 T C 15: 98,529,015 T242A probably benign Het
Kif28 C T 1: 179,708,480 G543D probably benign Het
Lsg1 A G 16: 30,582,601 S93P possibly damaging Het
Med23 T A 10: 24,905,953 C1052S probably benign Het
Mgam G T 6: 40,709,218 probably null Het
Mtmr4 C T 11: 87,611,876 R919W probably damaging Het
Muc5ac G T 7: 141,813,799 V2986L possibly damaging Het
Myo5b A G 18: 74,731,731 E1340G probably benign Het
Nkd2 T C 13: 73,846,959 D40G possibly damaging Het
Nudt5 T C 2: 5,864,368 L135S probably damaging Het
Oca2 A C 7: 56,331,972 D614A probably damaging Het
Olfr1 A G 11: 73,388,363 V221A possibly damaging Het
Olfr1058 T A 2: 86,386,171 L82F probably damaging Het
Olfr770 A C 10: 129,133,980 probably null Het
Plec C A 15: 76,185,644 A991S unknown Het
Plekhg2 G A 7: 28,361,928 R817C probably damaging Het
Plrg1 T A 3: 83,058,682 L48H probably damaging Het
Prx A G 7: 27,507,972 E18G probably damaging Het
Ptprf T C 4: 118,212,748 Y1479C probably damaging Het
Rap1b A T 10: 117,817,452 Y159* probably null Het
Rbck1 T C 2: 152,324,292 E242G possibly damaging Het
Rxfp1 T C 3: 79,650,461 D570G probably benign Het
Slc35f5 G T 1: 125,584,538 L358F probably damaging Het
Smarcd2 A G 11: 106,265,761 W274R probably damaging Het
Ssu72 A G 4: 155,731,329 T77A probably benign Het
Tex33 T C 15: 78,386,316 D84G probably benign Het
Tomm40 G A 7: 19,702,904 T297I possibly damaging Het
Urb1 A T 16: 90,761,634 I1743N probably damaging Het
Utp20 G A 10: 88,753,006 R2434C probably damaging Het
Other mutations in Chat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Chat APN 14 32449023 missense probably damaging 0.98
IGL01618:Chat APN 14 32446892 unclassified probably null
IGL02192:Chat APN 14 32423322 missense possibly damaging 0.94
IGL02418:Chat APN 14 32446949 missense possibly damaging 0.74
IGL02851:Chat APN 14 32458613 missense probably benign
IGL02966:Chat APN 14 32448946 missense probably damaging 1.00
IGL03401:Chat APN 14 32452569 missense probably damaging 1.00
R0511:Chat UTSW 14 32409019 missense probably damaging 1.00
R1462:Chat UTSW 14 32420778 missense probably damaging 1.00
R1462:Chat UTSW 14 32420778 missense probably damaging 1.00
R1729:Chat UTSW 14 32446795 missense probably damaging 1.00
R1782:Chat UTSW 14 32408987 missense probably damaging 1.00
R1972:Chat UTSW 14 32424191 missense probably benign 0.03
R1973:Chat UTSW 14 32424191 missense probably benign 0.03
R2061:Chat UTSW 14 32446873 missense probably benign 0.00
R2270:Chat UTSW 14 32454581 missense probably damaging 0.99
R4012:Chat UTSW 14 32423312 missense possibly damaging 0.56
R4601:Chat UTSW 14 32424155 missense probably benign 0.00
R4620:Chat UTSW 14 32453818 missense probably damaging 1.00
R4760:Chat UTSW 14 32453737 missense probably benign
R4885:Chat UTSW 14 32454610 missense probably damaging 1.00
R4899:Chat UTSW 14 32448977 missense possibly damaging 0.80
R4940:Chat UTSW 14 32419105 missense probably damaging 1.00
R4960:Chat UTSW 14 32420814 missense possibly damaging 0.86
R5094:Chat UTSW 14 32408939 missense probably damaging 1.00
R6039:Chat UTSW 14 32449027 missense probably damaging 1.00
R6039:Chat UTSW 14 32449027 missense probably damaging 1.00
R6621:Chat UTSW 14 32419013 missense probably damaging 0.97
R6648:Chat UTSW 14 32454694 missense probably benign 0.17
R6980:Chat UTSW 14 32424154 missense probably benign 0.15
R7203:Chat UTSW 14 32419057 missense probably damaging 1.00
R7336:Chat UTSW 14 32423256 splice site probably null
X0014:Chat UTSW 14 32446933 missense probably benign 0.01
X0066:Chat UTSW 14 32453831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTCCTGTAGGACATTGGC -3'
(R):5'- TGTCCAATCATGCATGCCAAC -3'

Sequencing Primer
(F):5'- ACTCCTGTAGGACATTGGCTAGTG -3'
(R):5'- TCTTAAGATACAGGAACTCACTGGGC -3'
Posted On2019-10-17