Incidental Mutation 'R0616:Tenm3'
ID58328
Institutional Source Beutler Lab
Gene Symbol Tenm3
Ensembl Gene ENSMUSG00000031561
Gene Nameteneurin transmembrane protein 3
SynonymsTen-m3, Odz3, 2610100B16Rik
MMRRC Submission 038805-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.707) question?
Stock #R0616 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location48227682-48843951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48276156 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1605 (I1605T)
Ref Sequence ENSEMBL: ENSMUSP00000033965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000190840]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033965
AA Change: I1605T

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: I1605T

DomainStartEndE-ValueType
Pfam:Ten_N 11 177 6.9e-91 PFAM
Pfam:Ten_N 171 308 1e-72 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2631 2708 1.5e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145344
Predicted Effect probably benign
Transcript: ENSMUST00000190840
AA Change: I1589T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: I1589T

DomainStartEndE-ValueType
Pfam:Ten_N 10 182 7.6e-77 PFAM
Pfam:Ten_N 168 308 6.6e-50 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2630 2708 3.2e-35 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik G T 14: 49,773,656 T198K possibly damaging Het
Abca12 G T 1: 71,302,671 Q1044K probably damaging Het
Abi3bp A T 16: 56,654,070 T723S probably damaging Het
Ackr3 G A 1: 90,214,469 V217I probably benign Het
Acnat2 A G 4: 49,380,269 S370P probably damaging Het
Arap1 A G 7: 101,401,650 R1152G possibly damaging Het
Arhgap15 G A 2: 44,116,717 probably null Het
Arhgap5 C T 12: 52,517,065 T273I possibly damaging Het
BC017158 A T 7: 128,272,631 probably null Het
C1s2 T C 6: 124,628,764 E332G probably damaging Het
Camp G A 9: 109,848,639 R88W probably benign Het
Cdkl2 A G 5: 92,009,004 M564T probably benign Het
Ceacam20 A G 7: 19,970,396 H124R probably benign Het
Cep19 C T 16: 32,104,011 R32C probably damaging Het
Cep295 G A 9: 15,332,322 Q1565* probably null Het
Chd3 T C 11: 69,345,487 E1932G probably damaging Het
Cnr2 G T 4: 135,917,562 W317L probably benign Het
Cntnap5a C T 1: 116,580,549 H1264Y possibly damaging Het
Depdc7 T A 2: 104,727,305 N200I probably benign Het
Dock4 T C 12: 40,704,415 S468P probably benign Het
Dscc1 C A 15: 55,083,570 C253F probably benign Het
Fam126a T C 5: 23,986,772 T44A probably damaging Het
Fam217a C A 13: 34,913,683 S55I probably benign Het
Fam92a G A 4: 12,168,234 R210* probably null Het
Farp1 G A 14: 121,277,022 R921H probably damaging Het
Fat4 A G 3: 38,942,870 D1746G probably damaging Het
Fbxw5 T C 2: 25,502,505 F100L probably damaging Het
Gli3 C A 13: 15,662,406 T458K possibly damaging Het
Gm4841 T C 18: 60,270,937 Y28C probably benign Het
Gprc5d T C 6: 135,116,432 E159G probably benign Het
Grm4 A T 17: 27,434,564 I757N probably damaging Het
Hagh A G 17: 24,857,577 Y94C probably damaging Het
Itpkb T C 1: 180,421,736 I892T probably damaging Het
Kcmf1 T C 6: 72,850,484 I58V probably benign Het
Khdrbs2 A G 1: 32,467,775 I167V possibly damaging Het
Kmt2c A G 5: 25,299,252 I275T probably benign Het
Lingo4 A G 3: 94,403,081 K442R probably benign Het
Mak T C 13: 41,042,185 N382D probably benign Het
Maob G A X: 16,710,163 T480I possibly damaging Het
Mcoln1 A G 8: 3,515,025 E573G probably benign Het
Ms4a6b G A 19: 11,526,898 probably null Het
Muc5ac A G 7: 141,796,244 M576V probably benign Het
Nme8 T A 13: 19,690,859 D126V probably benign Het
Npy2r T A 3: 82,541,363 D35V possibly damaging Het
Nrxn1 T C 17: 90,362,857 D193G probably damaging Het
Olfr1257 T A 2: 89,881,591 V255E probably benign Het
Olfr130 A C 17: 38,067,240 E23A probably damaging Het
Olfr1391 T C 11: 49,327,756 L115P probably damaging Het
Olfr1537 G A 9: 39,237,650 T258M probably benign Het
Olfr214 A G 6: 116,556,928 I168V probably benign Het
Olfr548-ps1 T A 7: 102,542,554 M206K possibly damaging Het
Olfr895 G T 9: 38,269,334 V266L probably benign Het
Olfr918 A T 9: 38,673,480 M1K probably null Het
Olfr984 A T 9: 40,100,987 F168I probably damaging Het
Pabpc2 A T 18: 39,773,739 H19L possibly damaging Het
Pcdhb9 A T 18: 37,401,975 K341* probably null Het
Pde4dip T C 3: 97,747,533 I859M probably benign Het
Pfkfb2 T C 1: 130,706,422 probably null Het
Pigg C T 5: 108,314,085 T94M probably damaging Het
Pik3c2b T C 1: 133,100,831 F1353L probably damaging Het
Prg4 T C 1: 150,460,711 D87G probably damaging Het
Prkdc A T 16: 15,690,407 D974V probably damaging Het
Prmt3 A G 7: 49,787,328 Y217C probably damaging Het
Proser1 A G 3: 53,474,697 T192A probably damaging Het
Rab3d G A 9: 21,914,764 T118M probably damaging Het
Rb1cc1 A G 1: 6,244,262 K386R possibly damaging Het
Rcn2 A G 9: 56,056,250 D221G probably benign Het
Rhbdl3 T G 11: 80,331,861 H245Q probably damaging Het
Ribc1 T C X: 152,005,791 E204G probably damaging Het
Rpap1 G A 2: 119,778,120 L254F probably damaging Het
Rrp12 A G 19: 41,892,549 F148L possibly damaging Het
Setdb1 A T 3: 95,341,798 I333K probably damaging Het
Simc1 A G 13: 54,547,032 I1210V probably benign Het
Smchd1 T A 17: 71,379,574 D1379V probably benign Het
Snap29 A T 16: 17,422,506 K159* probably null Het
Spdye4c A T 2: 128,594,212 K176M possibly damaging Het
Stk31 T A 6: 49,423,485 W415R probably damaging Het
Supt6 C T 11: 78,209,495 R1497Q probably damaging Het
Ttn T C 2: 76,846,623 probably null Het
Ttn A G 2: 76,897,667 probably benign Het
Ucp3 A T 7: 100,480,161 T68S probably benign Het
Ugt2b36 T C 5: 87,089,477 N316D probably benign Het
Usp4 T G 9: 108,366,804 S247A probably benign Het
Utp20 A T 10: 88,770,751 V1653D probably benign Het
Vmn1r183 A G 7: 24,054,825 I18V probably benign Het
Vmn1r237 A G 17: 21,314,623 M203V probably damaging Het
Vmn1r61 A T 7: 5,610,999 F105L possibly damaging Het
Zfp462 T C 4: 55,011,951 C158R probably damaging Het
Zfyve16 C G 13: 92,521,129 R758P probably damaging Het
Other mutations in Tenm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tenm3 APN 8 48417060 missense probably damaging 1.00
IGL00538:Tenm3 APN 8 48236025 missense probably damaging 1.00
IGL00719:Tenm3 APN 8 48279042 missense probably benign 0.39
IGL00720:Tenm3 APN 8 48276421 missense probably damaging 0.98
IGL00870:Tenm3 APN 8 48417132 missense probably benign 0.00
IGL00976:Tenm3 APN 8 48256841 missense probably benign 0.14
IGL01469:Tenm3 APN 8 48236423 missense probably damaging 1.00
IGL01508:Tenm3 APN 8 48276645 missense probably benign 0.09
IGL01590:Tenm3 APN 8 48228802 missense probably damaging 1.00
IGL01610:Tenm3 APN 8 48254477 missense probably damaging 1.00
IGL01874:Tenm3 APN 8 48236758 nonsense probably null
IGL01892:Tenm3 APN 8 48276396 missense probably benign 0.09
IGL02098:Tenm3 APN 8 48276576 missense possibly damaging 0.94
IGL02382:Tenm3 APN 8 48235476 missense probably damaging 1.00
IGL02397:Tenm3 APN 8 48236694 missense possibly damaging 0.94
IGL02475:Tenm3 APN 8 48279198 splice site probably benign
IGL02502:Tenm3 APN 8 48288016 missense probably damaging 1.00
IGL02508:Tenm3 APN 8 48299639 missense probably benign 0.30
IGL02543:Tenm3 APN 8 48298956 missense probably damaging 1.00
IGL02723:Tenm3 APN 8 48276903 missense probably benign 0.02
IGL03037:Tenm3 APN 8 48298878 missense possibly damaging 0.90
IGL03160:Tenm3 APN 8 48646418 missense probably benign 0.05
IGL03268:Tenm3 APN 8 48235523 missense probably damaging 1.00
IGL02988:Tenm3 UTSW 8 48235346 missense probably damaging 0.99
PIT4431001:Tenm3 UTSW 8 48235607 missense probably damaging 1.00
PIT4504001:Tenm3 UTSW 8 48293657 missense probably damaging 1.00
R0079:Tenm3 UTSW 8 48343345 missense possibly damaging 0.90
R0121:Tenm3 UTSW 8 48342659 missense probably damaging 0.99
R0123:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0134:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0147:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0148:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0309:Tenm3 UTSW 8 48341034 missense probably damaging 1.00
R0322:Tenm3 UTSW 8 48236912 splice site probably benign
R0335:Tenm3 UTSW 8 48232105 missense probably damaging 1.00
R0355:Tenm3 UTSW 8 48228975 missense probably damaging 1.00
R0411:Tenm3 UTSW 8 48287791 missense possibly damaging 0.61
R0505:Tenm3 UTSW 8 48341160 splice site probably benign
R0573:Tenm3 UTSW 8 48674399 splice site probably benign
R0599:Tenm3 UTSW 8 48277710 missense probably damaging 1.00
R0637:Tenm3 UTSW 8 48236525 missense probably damaging 1.00
R0726:Tenm3 UTSW 8 48236594 missense probably damaging 1.00
R0840:Tenm3 UTSW 8 48335742 missense probably damaging 0.99
R0981:Tenm3 UTSW 8 48298965 missense probably damaging 1.00
R1006:Tenm3 UTSW 8 48228542 missense probably damaging 1.00
R1199:Tenm3 UTSW 8 48235582 missense probably damaging 0.99
R1223:Tenm3 UTSW 8 48240396 missense possibly damaging 0.72
R1240:Tenm3 UTSW 8 48287893 missense possibly damaging 0.74
R1394:Tenm3 UTSW 8 48276400 missense probably benign
R1455:Tenm3 UTSW 8 48279048 missense possibly damaging 0.87
R1459:Tenm3 UTSW 8 48235971 missense probably damaging 1.00
R1473:Tenm3 UTSW 8 48310625 missense probably damaging 1.00
R1501:Tenm3 UTSW 8 48343316 missense probably damaging 0.99
R1507:Tenm3 UTSW 8 48287822 missense probably benign 0.01
R1522:Tenm3 UTSW 8 48395576 missense probably damaging 1.00
R1524:Tenm3 UTSW 8 48228981 missense possibly damaging 0.92
R1553:Tenm3 UTSW 8 48236421 missense probably damaging 1.00
R1572:Tenm3 UTSW 8 48228993 missense possibly damaging 0.94
R1583:Tenm3 UTSW 8 48279074 missense probably benign 0.09
R1676:Tenm3 UTSW 8 48417119 missense possibly damaging 0.83
R1732:Tenm3 UTSW 8 48310634 missense probably damaging 1.00
R1768:Tenm3 UTSW 8 48232104 missense probably damaging 1.00
R1777:Tenm3 UTSW 8 48417179 missense probably benign 0.05
R1793:Tenm3 UTSW 8 48674544 missense probably damaging 0.98
R1801:Tenm3 UTSW 8 48276256 missense probably benign 0.39
R1863:Tenm3 UTSW 8 48276346 missense probably benign 0.20
R1898:Tenm3 UTSW 8 48310761 missense probably damaging 1.00
R1971:Tenm3 UTSW 8 48236313 missense probably damaging 1.00
R1972:Tenm3 UTSW 8 48228591 missense probably damaging 1.00
R1996:Tenm3 UTSW 8 48228668 missense probably damaging 1.00
R2061:Tenm3 UTSW 8 48342256 critical splice donor site probably null
R2109:Tenm3 UTSW 8 48343349 missense possibly damaging 0.94
R2124:Tenm3 UTSW 8 48417006 critical splice donor site probably null
R2190:Tenm3 UTSW 8 48395544 missense probably damaging 1.00
R2204:Tenm3 UTSW 8 48674550 missense probably benign 0.17
R2233:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2234:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2235:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2237:Tenm3 UTSW 8 48342337 missense probably damaging 1.00
R2418:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2419:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2435:Tenm3 UTSW 8 48287953 missense probably damaging 1.00
R2483:Tenm3 UTSW 8 48240270 missense probably damaging 0.99
R3406:Tenm3 UTSW 8 48228555 missense probably damaging 1.00
R3724:Tenm3 UTSW 8 48277746 missense probably damaging 0.97
R4009:Tenm3 UTSW 8 48349223 missense probably damaging 1.00
R4210:Tenm3 UTSW 8 48349404 missense probably damaging 1.00
R4293:Tenm3 UTSW 8 48395658 missense probably damaging 1.00
R4656:Tenm3 UTSW 8 48293726 missense probably damaging 1.00
R4663:Tenm3 UTSW 8 48235970 missense probably damaging 1.00
R4835:Tenm3 UTSW 8 48313236 critical splice donor site probably null
R4851:Tenm3 UTSW 8 48310621 critical splice donor site probably null
R4867:Tenm3 UTSW 8 48235821 missense probably damaging 1.00
R4892:Tenm3 UTSW 8 48276861 missense probably damaging 0.99
R4895:Tenm3 UTSW 8 48300971 missense probably damaging 1.00
R4962:Tenm3 UTSW 8 48278961 nonsense probably null
R4995:Tenm3 UTSW 8 48229137 missense possibly damaging 0.87
R4996:Tenm3 UTSW 8 48235826 missense probably damaging 0.97
R5091:Tenm3 UTSW 8 48342308 missense probably benign 0.14
R5228:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5253:Tenm3 UTSW 8 48229198 missense possibly damaging 0.92
R5260:Tenm3 UTSW 8 48236855 missense probably damaging 1.00
R5363:Tenm3 UTSW 8 48287831 missense possibly damaging 0.55
R5414:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5427:Tenm3 UTSW 8 48236564 missense probably damaging 1.00
R5431:Tenm3 UTSW 8 48367377 nonsense probably null
R5566:Tenm3 UTSW 8 48279006 missense probably damaging 1.00
R5579:Tenm3 UTSW 8 48236764 missense probably damaging 1.00
R5656:Tenm3 UTSW 8 48228762 missense probably damaging 1.00
R5931:Tenm3 UTSW 8 48646498 missense probably benign 0.00
R5959:Tenm3 UTSW 8 48646447 nonsense probably null
R5965:Tenm3 UTSW 8 48228508 nonsense probably null
R6062:Tenm3 UTSW 8 48343406 missense possibly damaging 0.46
R6151:Tenm3 UTSW 8 48395573 missense probably damaging 1.00
R6157:Tenm3 UTSW 8 48298808 missense probably damaging 0.96
R6167:Tenm3 UTSW 8 48254622 missense possibly damaging 0.46
R6217:Tenm3 UTSW 8 48293665 missense probably damaging 0.99
R6233:Tenm3 UTSW 8 48417059 missense probably damaging 1.00
R6270:Tenm3 UTSW 8 48367394 missense probably damaging 0.98
R6329:Tenm3 UTSW 8 48276849 missense probably damaging 0.99
R6466:Tenm3 UTSW 8 48236063 missense probably damaging 0.97
R6515:Tenm3 UTSW 8 48417222 missense probably benign
R6516:Tenm3 UTSW 8 48417222 missense probably benign
R6747:Tenm3 UTSW 8 48343243 missense probably damaging 1.00
R6782:Tenm3 UTSW 8 48646256 critical splice donor site probably null
R6788:Tenm3 UTSW 8 48674493 missense probably damaging 1.00
R6823:Tenm3 UTSW 8 48256837 missense probably damaging 0.99
R6846:Tenm3 UTSW 8 48276738 missense probably benign 0.39
R6913:Tenm3 UTSW 8 48298937 missense probably damaging 0.99
R6941:Tenm3 UTSW 8 48674416 missense probably damaging 0.99
R6950:Tenm3 UTSW 8 48240479 nonsense probably null
R6968:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6970:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6993:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R7003:Tenm3 UTSW 8 48240444 missense probably damaging 1.00
R7125:Tenm3 UTSW 8 48674553 missense probably benign 0.00
R7140:Tenm3 UTSW 8 48292236 missense probably damaging 1.00
R7222:Tenm3 UTSW 8 48300969 missense probably damaging 1.00
R7232:Tenm3 UTSW 8 48235935 missense probably damaging 1.00
R7336:Tenm3 UTSW 8 48236177 missense possibly damaging 0.93
R7417:Tenm3 UTSW 8 48236183 missense probably damaging 1.00
R7526:Tenm3 UTSW 8 48287812 missense probably damaging 0.96
R7527:Tenm3 UTSW 8 48276600 missense possibly damaging 0.60
R7616:Tenm3 UTSW 8 48341049 missense possibly damaging 0.56
R7662:Tenm3 UTSW 8 48335727 missense probably benign 0.27
R7734:Tenm3 UTSW 8 48646333 missense probably damaging 1.00
R7802:Tenm3 UTSW 8 48236465 missense probably damaging 1.00
R7812:Tenm3 UTSW 8 48276300 missense probably benign 0.01
R7843:Tenm3 UTSW 8 48229111 nonsense probably null
R7926:Tenm3 UTSW 8 48229111 nonsense probably null
X0010:Tenm3 UTSW 8 48287829 missense probably damaging 0.98
X0025:Tenm3 UTSW 8 48236477 missense probably damaging 1.00
Z1177:Tenm3 UTSW 8 48276780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAATGTCAGTTCCCGAGGAGAGG -3'
(R):5'- ATGCCAAACTCAATGCGCCGTC -3'

Sequencing Primer
(F):5'- gaaatttaatctctgaggcatttcac -3'
(R):5'- AGATGGCACTCTGTACATTGC -3'
Posted On2013-07-11