Incidental Mutation 'R7530:Ifnar2'
ID583284
Institutional Source Beutler Lab
Gene Symbol Ifnar2
Ensembl Gene ENSMUSG00000022971
Gene Nameinterferon (alpha and beta) receptor 2
SynonymsIfnar-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R7530 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location91372783-91405589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91404313 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 481 (S481G)
Ref Sequence ENSEMBL: ENSMUSP00000023693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023691] [ENSMUST00000023693] [ENSMUST00000089042] [ENSMUST00000156133]
Predicted Effect probably benign
Transcript: ENSMUST00000023691
SMART Domains Protein: ENSMUSP00000023691
Gene: ENSMUSG00000022969

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 23 100 4.6e-2 SMART
FN3 114 204 7.1e-3 SMART
transmembrane domain 228 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023693
AA Change: S481G

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000023693
Gene: ENSMUSG00000022971
AA Change: S481G

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 118 8.9e-18 PFAM
Pfam:Interfer-bind 132 231 9.2e-19 PFAM
low complexity region 315 326 N/A INTRINSIC
low complexity region 361 389 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089042
SMART Domains Protein: ENSMUSP00000086443
Gene: ENSMUSG00000022971

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 118 2.9e-18 PFAM
Pfam:Interfer-bind 132 231 1.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144215
SMART Domains Protein: ENSMUSP00000120485
Gene: ENSMUSG00000022969

DomainStartEndE-ValueType
Pfam:Tissue_fac 7 65 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156133
SMART Domains Protein: ENSMUSP00000120227
Gene: ENSMUSG00000022969

DomainStartEndE-ValueType
low complexity region 39 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160764
SMART Domains Protein: ENSMUSP00000123997
Gene: ENSMUSG00000093701

DomainStartEndE-ValueType
FN3 2 92 5.1e1 SMART
FN3 110 187 9.09e0 SMART
FN3 201 291 1.39e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161517
SMART Domains Protein: ENSMUSP00000125579
Gene: ENSMUSG00000093701

DomainStartEndE-ValueType
Pfam:Interfer-bind 1 100 7.5e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. Multiple transcript variants encoding at least two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with mutations of this gene have defects in immune responses involving, variously, NK cells, CD4+ and CD8+ T cells and B cells in response to induced and transplanted tumors, viruses, and double stranded DNA. These defects include diminished secretion of type I and type II interferons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,948,721 Y43* probably null Het
6430550D23Rik C T 2: 156,003,920 V6I probably benign Het
AI314180 A G 4: 58,815,317 M1322T probably damaging Het
Atp10a A G 7: 58,773,976 T230A probably benign Het
Atp5g2 A T 15: 102,667,748 M1K probably null Het
Atp8a1 A C 5: 67,745,628 L535R Het
Bsn A G 9: 108,111,956 I2199T probably damaging Het
Ccdc73 A G 2: 104,994,570 T155A Het
Cdc42bpg T G 19: 6,322,275 F1430L probably benign Het
Cdc42bpg G T 19: 6,322,276 V1431L probably benign Het
Chat A T 14: 32,408,958 Y575* probably null Het
Col6a4 A T 9: 106,068,390 C842S probably damaging Het
Coq2 T C 5: 100,674,142 S34G probably benign Het
Crybg1 C T 10: 43,999,073 A680T possibly damaging Het
Ctsr T A 13: 61,163,117 K38N probably damaging Het
Dpm2 T C 2: 32,572,301 F33S probably damaging Het
Ext2 T A 2: 93,661,653 H564L probably benign Het
Fbxl2 G T 9: 113,989,173 H202N probably benign Het
Fra10ac1 A T 19: 38,215,905 Y74* probably null Het
Greb1 T A 12: 16,717,206 I332F probably benign Het
Igkv9-123 G A 6: 67,954,397 P62S possibly damaging Het
Iqub T C 6: 24,450,623 Q659R probably benign Het
Kansl2 T C 15: 98,529,015 T242A probably benign Het
Kif28 C T 1: 179,708,480 G543D probably benign Het
Lsg1 A G 16: 30,582,601 S93P possibly damaging Het
Med23 T A 10: 24,905,953 C1052S probably benign Het
Mgam G T 6: 40,709,218 probably null Het
Mtmr4 C T 11: 87,611,876 R919W probably damaging Het
Muc5ac G T 7: 141,813,799 V2986L possibly damaging Het
Myo5b A G 18: 74,731,731 E1340G probably benign Het
Nkd2 T C 13: 73,846,959 D40G possibly damaging Het
Nudt5 T C 2: 5,864,368 L135S probably damaging Het
Oca2 A C 7: 56,331,972 D614A probably damaging Het
Olfr1 A G 11: 73,388,363 V221A possibly damaging Het
Olfr1058 T A 2: 86,386,171 L82F probably damaging Het
Olfr770 A C 10: 129,133,980 probably null Het
Plec C A 15: 76,185,644 A991S unknown Het
Plekhg2 G A 7: 28,361,928 R817C probably damaging Het
Plrg1 T A 3: 83,058,682 L48H probably damaging Het
Prx A G 7: 27,507,972 E18G probably damaging Het
Ptprf T C 4: 118,212,748 Y1479C probably damaging Het
Rap1b A T 10: 117,817,452 Y159* probably null Het
Rbck1 T C 2: 152,324,292 E242G possibly damaging Het
Rxfp1 T C 3: 79,650,461 D570G probably benign Het
Slc35f5 G T 1: 125,584,538 L358F probably damaging Het
Smarcd2 A G 11: 106,265,761 W274R probably damaging Het
Ssu72 A G 4: 155,731,329 T77A probably benign Het
Tex33 T C 15: 78,386,316 D84G probably benign Het
Tomm40 G A 7: 19,702,904 T297I possibly damaging Het
Urb1 A T 16: 90,761,634 I1743N probably damaging Het
Utp20 G A 10: 88,753,006 R2434C probably damaging Het
Other mutations in Ifnar2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Ifnar2 APN 16 91391711 unclassified probably benign
IGL02817:Ifnar2 APN 16 91387992 missense probably benign 0.01
macro-2 UTSW 16 91383899 start codon destroyed probably null
R0701:Ifnar2 UTSW 16 91404229 missense possibly damaging 0.53
R1342:Ifnar2 UTSW 16 91403921 missense possibly damaging 0.85
R1542:Ifnar2 UTSW 16 91399265 missense possibly damaging 0.95
R1631:Ifnar2 UTSW 16 91391867 missense probably benign 0.00
R1913:Ifnar2 UTSW 16 91404170 missense probably benign 0.33
R3078:Ifnar2 UTSW 16 91386001 missense possibly damaging 0.86
R4193:Ifnar2 UTSW 16 91404344 missense probably damaging 0.98
R4592:Ifnar2 UTSW 16 91391796 missense probably benign
R5385:Ifnar2 UTSW 16 91404198 missense possibly damaging 0.70
R5545:Ifnar2 UTSW 16 91385025 critical splice donor site probably null
R5645:Ifnar2 UTSW 16 91404227 missense possibly damaging 0.85
R6223:Ifnar2 UTSW 16 91387988 missense probably damaging 0.98
R6371:Ifnar2 UTSW 16 91388098 missense possibly damaging 0.95
R6710:Ifnar2 UTSW 16 91393883 missense probably damaging 0.98
R6929:Ifnar2 UTSW 16 91393878 nonsense probably null
R7763:Ifnar2 UTSW 16 91399293 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACAACAGCTCCATGGATGAGC -3'
(R):5'- TCCATGACAGACACCTGGAG -3'

Sequencing Primer
(F):5'- GAGCCTGGGGACAACATTATCTTC -3'
(R):5'- TGGAGACCACAAGGCATCAAGTC -3'
Posted On2019-10-17