Mutagenetix > Incidental Mutations

Incidental Mutation 'R7530:Cdc42bpg'

583286

Institutional Source

Beutler Lab

Gene Symbol

Cdc42bpg

Ensembl Gene

ENSMUSG00000024769

Gene Name

CDC42 binding protein kinase gamma (DMPK-like)

Synonyms

MRCKgamma

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.309) question?

Stock #

R7530 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

6306456-6325652 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 6322275 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1430 (F1430L)

Ref Sequence

ENSEMBL: ENSMUSP00000025681 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025681]

Predicted Effect

probably benign
Transcript: ENSMUST00000025681
AA Change: F1430L

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000025681
Gene: ENSMUSG00000024769
AA Change: F1430L

Domain	Start	End	E-Value	Type
low complexity region	21	31	N/A	INTRINSIC
S_TKc	71	337	1.63e-87	SMART
S_TK_X	338	400	7.85e-12	SMART
coiled coil region	444	551	N/A	INTRINSIC
coiled coil region	630	675	N/A	INTRINSIC
Pfam:DMPK_coil	743	801	4.6e-21	PFAM
low complexity region	861	873	N/A	INTRINSIC
C1	878	926	1.78e-7	SMART
PH	947	1067	3.57e-10	SMART
Pfam:CNH	1096	1362	7.5e-56	PFAM
low complexity region	1401	1412	N/A	INTRINSIC
low complexity region	1535	1551	N/A	INTRINSIC

Meta Mutation Damage Score

0.0786

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

98% (52/53)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4430402I18Rik	A	T	19: 28,948,721	Y43*	probably null	Het
6430550D23Rik	C	T	2: 156,003,920	V6I	probably benign	Het
AI314180	A	G	4: 58,815,317	M1322T	probably damaging	Het
Atp10a	A	G	7: 58,773,976	T230A	probably benign	Het
Atp5g2	A	T	15: 102,667,748	M1K	probably null	Het
Atp8a1	A	C	5: 67,745,628	L535R		Het
Bsn	A	G	9: 108,111,956	I2199T	probably damaging	Het
Ccdc73	A	G	2: 104,994,570	T155A		Het
Chat	A	T	14: 32,408,958	Y575*	probably null	Het
Col6a4	A	T	9: 106,068,390	C842S	probably damaging	Het
Coq2	T	C	5: 100,674,142	S34G	probably benign	Het
Crybg1	C	T	10: 43,999,073	A680T	possibly damaging	Het
Ctsr	T	A	13: 61,163,117	K38N	probably damaging	Het
Dpm2	T	C	2: 32,572,301	F33S	probably damaging	Het
Ext2	T	A	2: 93,661,653	H564L	probably benign	Het
Fbxl2	G	T	9: 113,989,173	H202N	probably benign	Het
Fra10ac1	A	T	19: 38,215,905	Y74*	probably null	Het
Greb1	T	A	12: 16,717,206	I332F	probably benign	Het
Ifnar2	A	G	16: 91,404,313	S481G	probably benign	Het
Igkv9-123	G	A	6: 67,954,397	P62S	possibly damaging	Het
Iqub	T	C	6: 24,450,623	Q659R	probably benign	Het
Kansl2	T	C	15: 98,529,015	T242A	probably benign	Het
Kif28	C	T	1: 179,708,480	G543D	probably benign	Het
Lsg1	A	G	16: 30,582,601	S93P	possibly damaging	Het
Med23	T	A	10: 24,905,953	C1052S	probably benign	Het
Mgam	G	T	6: 40,709,218		probably null	Het
Mtmr4	C	T	11: 87,611,876	R919W	probably damaging	Het
Muc5ac	G	T	7: 141,813,799	V2986L	possibly damaging	Het
Myo5b	A	G	18: 74,731,731	E1340G	probably benign	Het
Nkd2	T	C	13: 73,846,959	D40G	possibly damaging	Het
Nudt5	T	C	2: 5,864,368	L135S	probably damaging	Het
Oca2	A	C	7: 56,331,972	D614A	probably damaging	Het
Olfr1	A	G	11: 73,388,363	V221A	possibly damaging	Het
Olfr1058	T	A	2: 86,386,171	L82F	probably damaging	Het
Olfr770	A	C	10: 129,133,980		probably null	Het
Plec	C	A	15: 76,185,644	A991S	unknown	Het
Plekhg2	G	A	7: 28,361,928	R817C	probably damaging	Het
Plrg1	T	A	3: 83,058,682	L48H	probably damaging	Het
Prx	A	G	7: 27,507,972	E18G	probably damaging	Het
Ptprf	T	C	4: 118,212,748	Y1479C	probably damaging	Het
Rap1b	A	T	10: 117,817,452	Y159*	probably null	Het
Rbck1	T	C	2: 152,324,292	E242G	possibly damaging	Het
Rxfp1	T	C	3: 79,650,461	D570G	probably benign	Het
Slc35f5	G	T	1: 125,584,538	L358F	probably damaging	Het
Smarcd2	A	G	11: 106,265,761	W274R	probably damaging	Het
Ssu72	A	G	4: 155,731,329	T77A	probably benign	Het
Tex33	T	C	15: 78,386,316	D84G	probably benign	Het
Tomm40	G	A	7: 19,702,904	T297I	possibly damaging	Het
Urb1	A	T	16: 90,761,634	I1743N	probably damaging	Het
Utp20	G	A	10: 88,753,006	R2434C	probably damaging	Het

Other mutations in Cdc42bpg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Cdc42bpg	APN	19	6312205	splice site	probably benign
IGL01415:Cdc42bpg	APN	19	6310851	missense	probably damaging	1.00
IGL01517:Cdc42bpg	APN	19	6318437	missense	probably damaging	1.00
IGL01585:Cdc42bpg	APN	19	6320432	missense	possibly damaging	0.93
IGL01743:Cdc42bpg	APN	19	6309823	critical splice donor site	probably null
IGL01930:Cdc42bpg	APN	19	6311368	missense	probably damaging	1.00
IGL02092:Cdc42bpg	APN	19	6316826	splice site	probably benign
IGL02355:Cdc42bpg	APN	19	6310809	missense	possibly damaging	0.93
IGL02362:Cdc42bpg	APN	19	6310809	missense	possibly damaging	0.93
IGL02498:Cdc42bpg	APN	19	6322793	missense	probably benign
IGL03004:Cdc42bpg	APN	19	6311383	missense	probably benign	0.38
IGL03037:Cdc42bpg	APN	19	6311200	missense	probably damaging	1.00
PIT1430001:Cdc42bpg	UTSW	19	6322552	splice site	probably null
R0304:Cdc42bpg	UTSW	19	6317248	missense	probably damaging	0.99
R0367:Cdc42bpg	UTSW	19	6311395	missense	probably damaging	1.00
R0412:Cdc42bpg	UTSW	19	6313457	missense	probably damaging	1.00
R0742:Cdc42bpg	UTSW	19	6318575	critical splice donor site	probably null
R1026:Cdc42bpg	UTSW	19	6317187	missense	probably damaging	1.00
R1056:Cdc42bpg	UTSW	19	6314021	missense	probably benign	0.10
R1065:Cdc42bpg	UTSW	19	6322826	missense	probably damaging	1.00
R1476:Cdc42bpg	UTSW	19	6313782	missense	probably damaging	0.99
R1854:Cdc42bpg	UTSW	19	6320807	missense	possibly damaging	0.67
R1936:Cdc42bpg	UTSW	19	6310309	missense	probably damaging	1.00
R1962:Cdc42bpg	UTSW	19	6306855	missense	probably damaging	1.00
R2070:Cdc42bpg	UTSW	19	6320488	missense	probably damaging	1.00
R2167:Cdc42bpg	UTSW	19	6317677	missense	probably damaging	1.00
R3826:Cdc42bpg	UTSW	19	6317645	missense	probably damaging	0.99
R3829:Cdc42bpg	UTSW	19	6317645	missense	probably damaging	0.99
R4190:Cdc42bpg	UTSW	19	6321681	missense	probably damaging	1.00
R4249:Cdc42bpg	UTSW	19	6315266	missense	possibly damaging	0.65
R4499:Cdc42bpg	UTSW	19	6320555	missense	possibly damaging	0.69
R4731:Cdc42bpg	UTSW	19	6311191	missense	probably damaging	1.00
R4732:Cdc42bpg	UTSW	19	6311191	missense	probably damaging	1.00
R4733:Cdc42bpg	UTSW	19	6311191	missense	probably damaging	1.00
R4797:Cdc42bpg	UTSW	19	6320447	missense	probably damaging	1.00
R4831:Cdc42bpg	UTSW	19	6311335	missense	probably damaging	0.97
R4984:Cdc42bpg	UTSW	19	6316223	missense	possibly damaging	0.88
R5092:Cdc42bpg	UTSW	19	6313220	missense	probably benign	0.01
R5135:Cdc42bpg	UTSW	19	6320618	missense	probably damaging	1.00
R5183:Cdc42bpg	UTSW	19	6321805	intron	probably benign
R5208:Cdc42bpg	UTSW	19	6321720	missense	probably benign	0.01
R5240:Cdc42bpg	UTSW	19	6315899	missense	probably damaging	1.00
R5475:Cdc42bpg	UTSW	19	6311071	missense	probably damaging	0.99
R5703:Cdc42bpg	UTSW	19	6322673	missense	possibly damaging	0.87
R5876:Cdc42bpg	UTSW	19	6310815	missense	probably damaging	1.00
R6024:Cdc42bpg	UTSW	19	6317496	missense	probably damaging	1.00
R6266:Cdc42bpg	UTSW	19	6311473	missense	probably damaging	1.00
R6450:Cdc42bpg	UTSW	19	6314488	splice site	probably null
R6493:Cdc42bpg	UTSW	19	6318455	missense	probably damaging	0.96
R6983:Cdc42bpg	UTSW	19	6321668	missense	probably damaging	1.00
R7080:Cdc42bpg	UTSW	19	6315189	missense	probably damaging	0.97
R7125:Cdc42bpg	UTSW	19	6322291	missense	probably damaging	1.00
R7183:Cdc42bpg	UTSW	19	6310797	missense	probably damaging	1.00
R7317:Cdc42bpg	UTSW	19	6314504	missense	probably benign	0.11
R7426:Cdc42bpg	UTSW	19	6318398	missense	probably damaging	1.00
R7504:Cdc42bpg	UTSW	19	6306784	missense	possibly damaging	0.85
R7530:Cdc42bpg	UTSW	19	6322276	missense	probably benign	0.12
R7739:Cdc42bpg	UTSW	19	6310815	missense	probably damaging	1.00
R7903:Cdc42bpg	UTSW	19	6313469	missense	possibly damaging	0.94
R8186:Cdc42bpg	UTSW	19	6306865	missense	probably damaging	1.00
R8331:Cdc42bpg	UTSW	19	6313447	missense	probably benign	0.08
Z1177:Cdc42bpg	UTSW	19	6309746	missense	probably damaging	1.00
Z1177:Cdc42bpg	UTSW	19	6314522	missense	possibly damaging	0.94
Z1177:Cdc42bpg	UTSW	19	6314523	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGCAAGCGCCGTTTCTTC -3'
(R):5'- GGAACTCAGCTACTGGCAATG -3'

Sequencing Primer
(F):5'- CTTCCGGGTGTCTGATGAGC -3'
(R):5'- ACTCAGCTACTGGCAATGAGGTC -3'

Posted On

2019-10-17