Incidental Mutation 'R7531:Nr1h3'
ID583295
Institutional Source Beutler Lab
Gene Symbol Nr1h3
Ensembl Gene ENSMUSG00000002108
Gene Namenuclear receptor subfamily 1, group H, member 3
SynonymsUnr1, LXR alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7531 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location91184061-91202834 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 91184394 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 427 (R427H)
Ref Sequence ENSEMBL: ENSMUSP00000002177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002177] [ENSMUST00000066420] [ENSMUST00000066473] [ENSMUST00000075269] [ENSMUST00000077941] [ENSMUST00000099723] [ENSMUST00000111354] [ENSMUST00000111355] [ENSMUST00000111356] [ENSMUST00000111370] [ENSMUST00000111371] [ENSMUST00000111372] [ENSMUST00000111376] [ENSMUST00000111381]
PDB Structure
Liver X-Receptor alpha Ligand Binding Domain with SB313987 [X-RAY DIFFRACTION]
humanRXR alpha & mouse LXR alpha complexed with Retenoic acid and GSK2186 [X-RAY DIFFRACTION]
hRXRalpha & mLXRalpha with an indole Pharmacophore, SB786875 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000002177
AA Change: R427H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002177
Gene: ENSMUSG00000002108
AA Change: R427H

DomainStartEndE-ValueType
ZnF_C4 93 164 1e-35 SMART
low complexity region 189 209 N/A INTRINSIC
HOLI 257 416 1.84e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066420
SMART Domains Protein: ENSMUSP00000067210
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066473
SMART Domains Protein: ENSMUSP00000069350
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075269
SMART Domains Protein: ENSMUSP00000074746
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 762 770 N/A INTRINSIC
low complexity region 797 820 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 1276 1290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077941
SMART Domains Protein: ENSMUSP00000077094
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1354 1368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099723
SMART Domains Protein: ENSMUSP00000097311
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1189 1203 N/A INTRINSIC
low complexity region 1353 1367 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111354
AA Change: R427H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106986
Gene: ENSMUSG00000002108
AA Change: R427H

DomainStartEndE-ValueType
ZnF_C4 93 164 1e-35 SMART
low complexity region 189 209 N/A INTRINSIC
HOLI 257 416 1.84e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111355
AA Change: R367H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106987
Gene: ENSMUSG00000002108
AA Change: R367H

DomainStartEndE-ValueType
ZnF_C4 93 164 1e-35 SMART
HOLI 202 356 3.76e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111356
AA Change: R427H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106988
Gene: ENSMUSG00000002108
AA Change: R427H

DomainStartEndE-ValueType
ZnF_C4 93 164 1e-35 SMART
low complexity region 189 209 N/A INTRINSIC
HOLI 257 416 1.84e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111370
SMART Domains Protein: ENSMUSP00000107001
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1334 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111371
SMART Domains Protein: ENSMUSP00000107002
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 762 770 N/A INTRINSIC
low complexity region 797 820 N/A INTRINSIC
low complexity region 909 919 N/A INTRINSIC
low complexity region 1296 1310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111372
SMART Domains Protein: ENSMUSP00000107003
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1295 1309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111376
SMART Domains Protein: ENSMUSP00000107007
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 721 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 908 918 N/A INTRINSIC
low complexity region 1151 1162 N/A INTRINSIC
low complexity region 1312 1326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111381
SMART Domains Protein: ENSMUSP00000107012
Gene: ENSMUSG00000040687

DomainStartEndE-ValueType
uDENN 7 97 7.11e-26 SMART
low complexity region 124 139 N/A INTRINSIC
DENN 171 401 2.19e-67 SMART
low complexity region 412 428 N/A INTRINSIC
dDENN 484 554 6.71e-13 SMART
low complexity region 619 639 N/A INTRINSIC
low complexity region 699 718 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
low complexity region 816 839 N/A INTRINSIC
low complexity region 928 938 N/A INTRINSIC
low complexity region 1315 1329 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NR1 subfamily of the nuclear receptor superfamily. The NR1 family members are key regulators of macrophage function, controlling transcriptional programs involved in lipid homeostasis and inflammation. This protein is highly expressed in visceral organs, including liver, kidney and intestine. It forms a heterodimer with retinoid X receptor (RXR), and regulates expression of target genes containing retinoid response elements. Studies in mice lacking this gene suggest that it may play an important role in the regulation of cholesterol homeostasis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased male fertility, increased suseceptibility to bacterial infection, and diet-sensitive increase in liver size, steatosis, and cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,140,231 F490L probably benign Het
Abca12 T A 1: 71,247,173 T2501S probably damaging Het
Abcg3 A G 5: 104,977,641 Y59H probably benign Het
Acsf2 G T 11: 94,573,231 probably null Het
Adam25 T A 8: 40,753,877 I60K probably damaging Het
Agrn A T 4: 156,169,804 V1729E probably damaging Het
Aldh9a1 G A 1: 167,350,326 V31I probably benign Het
Aqp5 T C 15: 99,591,299 F10L possibly damaging Het
Arfgap2 T A 2: 91,273,744 probably null Het
Asb7 T C 7: 66,679,136 H52R probably damaging Het
Aspa G A 11: 73,313,525 Q206* probably null Het
Bpgm A G 6: 34,504,288 I207V possibly damaging Het
Brinp2 A G 1: 158,266,572 S187P possibly damaging Het
Clec4e A G 6: 123,285,574 F128S probably benign Het
Crisp3 A G 17: 40,234,738 F82L probably benign Het
Cry2 A G 2: 92,413,005 L497P probably damaging Het
Dcxr A G 11: 120,727,006 V48A probably benign Het
Ddx11 A T 17: 66,138,219 T379S probably benign Het
Depdc1a A C 3: 159,522,639 T343P probably damaging Het
Dhx36 T C 3: 62,484,968 I546V probably damaging Het
Fam114a2 A G 11: 57,513,716 V74A probably benign Het
Flg2 A T 3: 93,200,870 R68S probably damaging Het
Glb1l3 T C 9: 26,853,654 I154V possibly damaging Het
Gm45844 T C 7: 7,240,186 T22A probably benign Het
Gramd2 A T 9: 59,709,910 I83F probably damaging Het
Hcn4 A G 9: 58,860,137 T994A unknown Het
Hectd1 C T 12: 51,806,367 V124I probably benign Het
Hmcn1 A T 1: 150,686,780 D2342E probably benign Het
Hyal6 A T 6: 24,740,787 H313L possibly damaging Het
Ifnab T A 4: 88,691,286 probably benign Het
Keap1 A G 9: 21,237,327 I128T probably benign Het
Kit T C 5: 75,607,040 S28P probably damaging Het
Krtap5-3 T A 7: 142,202,205 C260S unknown Het
Lepr T A 4: 101,752,175 W320R probably damaging Het
Lmod3 A T 6: 97,248,442 N139K probably benign Het
March1 C G 8: 66,386,337 S10R probably benign Het
Naa35 A T 13: 59,617,941 K380* probably null Het
Npy1r C A 8: 66,704,894 F285L probably damaging Het
Olfr507 T A 7: 108,622,062 N83K probably benign Het
Pate2 A G 9: 35,670,712 probably null Het
Pcmt1 A G 10: 7,680,605 probably null Het
Prg4 T G 1: 150,455,035 E629A unknown Het
Rin2 T G 2: 145,858,499 S199A probably benign Het
Ror1 T A 4: 100,441,191 L587Q probably damaging Het
Rsl1 T A 13: 67,176,502 C31S possibly damaging Het
Scn4a A G 11: 106,348,697 probably null Het
Sema3a T C 5: 13,565,838 Y410H probably damaging Het
Smpd5 T C 15: 76,296,339 V447A probably benign Het
Tax1bp1 A T 6: 52,746,697 D524V probably benign Het
Tesc A T 5: 118,059,458 Y179F probably damaging Het
Tm9sf2 T C 14: 122,142,412 S292P possibly damaging Het
Unc45b A G 11: 82,929,012 D543G probably damaging Het
Usp4 T A 9: 108,372,680 V469E probably damaging Het
Vmn1r10 T A 6: 57,113,939 I172N possibly damaging Het
Zfyve16 A G 13: 92,522,965 L146S probably damaging Het
Other mutations in Nr1h3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Nr1h3 APN 2 91190199 missense probably damaging 1.00
IGL02198:Nr1h3 APN 2 91192725 missense probably damaging 1.00
IGL02992:Nr1h3 APN 2 91190566 missense probably damaging 1.00
IGL03103:Nr1h3 APN 2 91192015 missense probably damaging 1.00
R0302:Nr1h3 UTSW 2 91192013 missense probably damaging 0.98
R0350:Nr1h3 UTSW 2 91191825 missense possibly damaging 0.68
R2397:Nr1h3 UTSW 2 91191857 missense possibly damaging 0.81
R2439:Nr1h3 UTSW 2 91190220 missense probably benign 0.45
R2988:Nr1h3 UTSW 2 91185004 missense probably damaging 0.96
R3431:Nr1h3 UTSW 2 91191860 missense probably damaging 1.00
R4842:Nr1h3 UTSW 2 91190218 missense probably benign 0.09
R5355:Nr1h3 UTSW 2 91191908 missense possibly damaging 0.67
R6137:Nr1h3 UTSW 2 91191851 missense probably damaging 1.00
R6982:Nr1h3 UTSW 2 91190759 missense probably damaging 0.98
R7380:Nr1h3 UTSW 2 91190195 missense possibly damaging 0.83
R7753:Nr1h3 UTSW 2 91185025 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGATCCCAACTGCCCAG -3'
(R):5'- CCACCTAGCATGCTAATTCCTG -3'

Sequencing Primer
(F):5'- TAATGCTACGCAAGGCTCTC -3'
(R):5'- AGCATGCTAATTCCTGTGTTTCTAAC -3'
Posted On2019-10-17