Mutagenetix > Incidental Mutation

Incidental Mutation 'R7531:Lmod3'

583313

Institutional Source

Beutler Lab

Gene Symbol

Lmod3

Ensembl Gene

ENSMUSG00000044086

Gene Name

leiomodin 3 (fetal)

Synonyms

5430424A14Rik

MMRRC Submission

045603-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R7531 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

97215495-97229720 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 97225403 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 139 (N139K)

Ref Sequence

ENSEMBL: ENSMUSP00000093315 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095655]

AlphaFold

E9QA62

Predicted Effect

probably benign
Transcript: ENSMUST00000095655
AA Change: N139K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000093315
Gene: ENSMUSG00000044086
AA Change: N139K

Domain	Start	End	E-Value	Type
Pfam:Tropomodulin	8	177	1.2e-13	PFAM
PDB:1IO0\|A	248	406	9e-46	PDB
SCOP:d1a4ya_	261	358	1e-3	SMART
low complexity region	407	427	N/A	INTRINSIC

Meta Mutation Damage Score

0.0814

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the leiomodin family of proteins. This protein contains three actin-binding domains, a tropomyosin domain, a leucine-rich repeat domain, and a Wiskott-Aldrich syndrome protein homology 2 domain (WH2). Localization of this protein to the pointed ends of thin filaments has been observed, and there is evidence that this protein acts as a catalyst of actin nucleation, and is important to the organization of sarcomeric thin filaments in skeletal muscles. Mutations in this gene have been associated as one cause of Nemaline myopathy, as other genes have also been linked to this disorder. Nemaline myopathy is a disorder characterized by nonprogressive generalized muscle weakness and protein inclusions (nemaline bodies) in skeletal myofibers. Patients with mutations in this gene often present with a severe congenital form of the disorder. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for an endonuclease-mediated mutation are runted and exhibit nemaline myopathy including a reduction in skeletal myofiber size, centrally nucleated skeletal muscle fibers, increase in skeletal muscle glycogen levels, and abnormal sarcomere and Z lines. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	A	1: 71,286,332 (GRCm39)	T2501S	probably damaging	Het
Abcg3	A	G	5: 105,125,507 (GRCm39)	Y59H	probably benign	Het
Acsf2	G	T	11: 94,464,057 (GRCm39)		probably null	Het
Adam25	T	A	8: 41,206,914 (GRCm39)	I60K	probably damaging	Het
Agrn	A	T	4: 156,254,261 (GRCm39)	V1729E	probably damaging	Het
Aldh9a1	G	A	1: 167,177,895 (GRCm39)	V31I	probably benign	Het
Aqp5	T	C	15: 99,489,180 (GRCm39)	F10L	possibly damaging	Het
Arfgap2	T	A	2: 91,104,089 (GRCm39)		probably null	Het
Asb7	T	C	7: 66,328,884 (GRCm39)	H52R	probably damaging	Het
Aspa	G	A	11: 73,204,351 (GRCm39)	Q206*	probably null	Het
Bpgm	A	G	6: 34,481,223 (GRCm39)	I207V	possibly damaging	Het
Brinp2	A	G	1: 158,094,142 (GRCm39)	S187P	possibly damaging	Het
Clec4e	A	G	6: 123,262,533 (GRCm39)	F128S	probably benign	Het
Crisp3	A	G	17: 40,545,629 (GRCm39)	F82L	probably benign	Het
Cry2	A	G	2: 92,243,350 (GRCm39)	L497P	probably damaging	Het
Dcxr	A	G	11: 120,617,832 (GRCm39)	V48A	probably benign	Het
Ddx11	A	T	17: 66,445,214 (GRCm39)	T379S	probably benign	Het
Depdc1a	A	C	3: 159,228,276 (GRCm39)	T343P	probably damaging	Het
Dhx36	T	C	3: 62,392,389 (GRCm39)	I546V	probably damaging	Het
Fam114a2	A	G	11: 57,404,542 (GRCm39)	V74A	probably benign	Het
Fcgbpl1	T	C	7: 27,839,656 (GRCm39)	F490L	probably benign	Het
Flg2	A	T	3: 93,108,177 (GRCm39)	R68S	probably damaging	Het
Glb1l3	T	C	9: 26,764,950 (GRCm39)	I154V	possibly damaging	Het
Gm45844	T	C	7: 7,243,185 (GRCm39)	T22A	probably benign	Het
Gramd2a	A	T	9: 59,617,193 (GRCm39)	I83F	probably damaging	Het
Hcn4	A	G	9: 58,767,420 (GRCm39)	T994A	unknown	Het
Hectd1	C	T	12: 51,853,150 (GRCm39)	V124I	probably benign	Het
Hmcn1	A	T	1: 150,562,531 (GRCm39)	D2342E	probably benign	Het
Hyal6	A	T	6: 24,740,786 (GRCm39)	H313L	possibly damaging	Het
Ifnab	T	A	4: 88,609,523 (GRCm39)		probably benign	Het
Keap1	A	G	9: 21,148,623 (GRCm39)	I128T	probably benign	Het
Kit	T	C	5: 75,767,700 (GRCm39)	S28P	probably damaging	Het
Krtap5-3	T	A	7: 141,755,942 (GRCm39)	C260S	unknown	Het
Lepr	T	A	4: 101,609,372 (GRCm39)	W320R	probably damaging	Het
Marchf1	C	G	8: 66,838,989 (GRCm39)	S10R	probably benign	Het
Naa35	A	T	13: 59,765,755 (GRCm39)	K380*	probably null	Het
Npy1r	C	A	8: 67,157,546 (GRCm39)	F285L	probably damaging	Het
Nr1h3	C	T	2: 91,014,739 (GRCm39)	R427H	probably damaging	Het
Or5p79	T	A	7: 108,221,269 (GRCm39)	N83K	probably benign	Het
Pate2	A	G	9: 35,582,008 (GRCm39)		probably null	Het
Pcmt1	A	G	10: 7,556,369 (GRCm39)		probably null	Het
Prg4	T	G	1: 150,330,786 (GRCm39)	E629A	unknown	Het
Rin2	T	G	2: 145,700,419 (GRCm39)	S199A	probably benign	Het
Ror1	T	A	4: 100,298,388 (GRCm39)	L587Q	probably damaging	Het
Rsl1	T	A	13: 67,324,566 (GRCm39)	C31S	possibly damaging	Het
Scn4a	A	G	11: 106,239,523 (GRCm39)		probably null	Het
Sema3a	T	C	5: 13,615,805 (GRCm39)	Y410H	probably damaging	Het
Smpd5	T	C	15: 76,180,539 (GRCm39)	V447A	probably benign	Het
Tax1bp1	A	T	6: 52,723,682 (GRCm39)	D524V	probably benign	Het
Tesc	A	T	5: 118,197,523 (GRCm39)	Y179F	probably damaging	Het
Tm9sf2	T	C	14: 122,379,824 (GRCm39)	S292P	possibly damaging	Het
Unc45b	A	G	11: 82,819,838 (GRCm39)	D543G	probably damaging	Het
Usp4	T	A	9: 108,249,879 (GRCm39)	V469E	probably damaging	Het
Vmn1r10	T	A	6: 57,090,924 (GRCm39)	I172N	possibly damaging	Het
Zfyve16	A	G	13: 92,659,473 (GRCm39)	L146S	probably damaging	Het

Other mutations in Lmod3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Lmod3	APN	6	97,229,258 (GRCm39)	missense	probably damaging	0.99
IGL00465:Lmod3	APN	6	97,224,822 (GRCm39)	missense	probably damaging	1.00
IGL01401:Lmod3	APN	6	97,229,513 (GRCm39)	missense	probably damaging	1.00
IGL02279:Lmod3	APN	6	97,224,633 (GRCm39)	missense	probably damaging	1.00
IGL02621:Lmod3	APN	6	97,215,796 (GRCm39)	utr 3 prime	probably benign
IGL03116:Lmod3	APN	6	97,224,156 (GRCm39)	missense	possibly damaging	0.92
Runted	UTSW	6	97,224,234 (GRCm39)	missense	probably damaging	1.00
R0086:Lmod3	UTSW	6	97,224,306 (GRCm39)	missense	probably damaging	1.00
R0627:Lmod3	UTSW	6	97,225,032 (GRCm39)	missense	probably damaging	0.96
R2208:Lmod3	UTSW	6	97,224,838 (GRCm39)	missense	probably benign	0.06
R4038:Lmod3	UTSW	6	97,225,275 (GRCm39)	missense	probably benign	0.06
R4913:Lmod3	UTSW	6	97,224,125 (GRCm39)	splice site	probably null
R5867:Lmod3	UTSW	6	97,224,963 (GRCm39)	missense	probably damaging	1.00
R5905:Lmod3	UTSW	6	97,224,575 (GRCm39)	missense	probably damaging	1.00
R6035:Lmod3	UTSW	6	97,224,234 (GRCm39)	missense	probably damaging	1.00
R6035:Lmod3	UTSW	6	97,224,234 (GRCm39)	missense	probably damaging	1.00
R6183:Lmod3	UTSW	6	97,229,514 (GRCm39)	missense	probably damaging	1.00
R6210:Lmod3	UTSW	6	97,224,262 (GRCm39)	missense	probably damaging	1.00
R6527:Lmod3	UTSW	6	97,224,339 (GRCm39)	missense	probably benign	0.00
R7225:Lmod3	UTSW	6	97,224,345 (GRCm39)	missense	probably benign	0.34
R7908:Lmod3	UTSW	6	97,225,434 (GRCm39)	missense	probably benign	0.05
R8022:Lmod3	UTSW	6	97,225,260 (GRCm39)	missense	probably benign
R8154:Lmod3	UTSW	6	97,224,941 (GRCm39)	missense	probably damaging	1.00
R8325:Lmod3	UTSW	6	97,224,379 (GRCm39)	missense	probably benign	0.06
R9149:Lmod3	UTSW	6	97,224,625 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGCTGTTTTAGTAGCCAGTTGC -3'
(R):5'- TGCATTCCTTTGTGAGATTAGC -3'

Sequencing Primer
(F):5'- CAGTTGCTGGTAGGTGCCC -3'
(R):5'- GCAAACATTTCTTAACTGCTGAGCC -3'

Posted On

2019-10-17