Incidental Mutation 'R7531:9530053A07Rik'
ID583316
Institutional Source Beutler Lab
Gene Symbol 9530053A07Rik
Ensembl Gene ENSMUSG00000078776
Gene NameRIKEN cDNA 9530053A07 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R7531 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location28129466-28164811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28140231 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 490 (F490L)
Ref Sequence ENSEMBL: ENSMUSP00000056479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]
Predicted Effect probably benign
Transcript: ENSMUST00000059886
AA Change: F490L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: F490L

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150948
AA Change: F490L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: F490L

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T A 1: 71,247,173 T2501S probably damaging Het
Abcg3 A G 5: 104,977,641 Y59H probably benign Het
Acsf2 G T 11: 94,573,231 probably null Het
Adam25 T A 8: 40,753,877 I60K probably damaging Het
Agrn A T 4: 156,169,804 V1729E probably damaging Het
Aldh9a1 G A 1: 167,350,326 V31I probably benign Het
Aqp5 T C 15: 99,591,299 F10L possibly damaging Het
Arfgap2 T A 2: 91,273,744 probably null Het
Asb7 T C 7: 66,679,136 H52R probably damaging Het
Aspa G A 11: 73,313,525 Q206* probably null Het
Bpgm A G 6: 34,504,288 I207V possibly damaging Het
Brinp2 A G 1: 158,266,572 S187P possibly damaging Het
Clec4e A G 6: 123,285,574 F128S probably benign Het
Crisp3 A G 17: 40,234,738 F82L probably benign Het
Cry2 A G 2: 92,413,005 L497P probably damaging Het
Dcxr A G 11: 120,727,006 V48A probably benign Het
Ddx11 A T 17: 66,138,219 T379S probably benign Het
Depdc1a A C 3: 159,522,639 T343P probably damaging Het
Dhx36 T C 3: 62,484,968 I546V probably damaging Het
Fam114a2 A G 11: 57,513,716 V74A probably benign Het
Flg2 A T 3: 93,200,870 R68S probably damaging Het
Glb1l3 T C 9: 26,853,654 I154V possibly damaging Het
Gm45844 T C 7: 7,240,186 T22A probably benign Het
Gramd2 A T 9: 59,709,910 I83F probably damaging Het
Hcn4 A G 9: 58,860,137 T994A unknown Het
Hectd1 C T 12: 51,806,367 V124I probably benign Het
Hmcn1 A T 1: 150,686,780 D2342E probably benign Het
Hyal6 A T 6: 24,740,787 H313L possibly damaging Het
Ifnab T A 4: 88,691,286 probably benign Het
Keap1 A G 9: 21,237,327 I128T probably benign Het
Kit T C 5: 75,607,040 S28P probably damaging Het
Krtap5-3 T A 7: 142,202,205 C260S unknown Het
Lepr T A 4: 101,752,175 W320R probably damaging Het
Lmod3 A T 6: 97,248,442 N139K probably benign Het
March1 C G 8: 66,386,337 S10R probably benign Het
Naa35 A T 13: 59,617,941 K380* probably null Het
Npy1r C A 8: 66,704,894 F285L probably damaging Het
Nr1h3 C T 2: 91,184,394 R427H probably damaging Het
Olfr507 T A 7: 108,622,062 N83K probably benign Het
Pate2 A G 9: 35,670,712 probably null Het
Pcmt1 A G 10: 7,680,605 probably null Het
Prg4 T G 1: 150,455,035 E629A unknown Het
Rin2 T G 2: 145,858,499 S199A probably benign Het
Ror1 T A 4: 100,441,191 L587Q probably damaging Het
Rsl1 T A 13: 67,176,502 C31S possibly damaging Het
Scn4a A G 11: 106,348,697 probably null Het
Sema3a T C 5: 13,565,838 Y410H probably damaging Het
Smpd5 T C 15: 76,296,339 V447A probably benign Het
Tax1bp1 A T 6: 52,746,697 D524V probably benign Het
Tesc A T 5: 118,059,458 Y179F probably damaging Het
Tm9sf2 T C 14: 122,142,412 S292P possibly damaging Het
Unc45b A G 11: 82,929,012 D543G probably damaging Het
Usp4 T A 9: 108,372,680 V469E probably damaging Het
Vmn1r10 T A 6: 57,113,939 I172N possibly damaging Het
Zfyve16 A G 13: 92,522,965 L146S probably damaging Het
Other mutations in 9530053A07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:9530053A07Rik APN 7 28164528 missense probably damaging 1.00
IGL00757:9530053A07Rik APN 7 28154445 missense probably damaging 1.00
IGL01015:9530053A07Rik APN 7 28155318 missense probably damaging 1.00
IGL01079:9530053A07Rik APN 7 28139778 missense probably damaging 0.99
IGL01343:9530053A07Rik APN 7 28150702 missense probably benign 0.19
IGL01420:9530053A07Rik APN 7 28140133 missense probably benign 0.28
IGL01604:9530053A07Rik APN 7 28155324 missense probably benign 0.11
IGL01666:9530053A07Rik APN 7 28153292 missense probably damaging 1.00
IGL02002:9530053A07Rik APN 7 28152796 missense probably damaging 1.00
IGL02036:9530053A07Rik APN 7 28137525 missense possibly damaging 0.82
IGL02126:9530053A07Rik APN 7 28139856 missense probably damaging 1.00
IGL02150:9530053A07Rik APN 7 28146779 nonsense probably null
IGL02219:9530053A07Rik APN 7 28154635 missense probably damaging 1.00
IGL02563:9530053A07Rik APN 7 28157892 missense probably benign
IGL02804:9530053A07Rik APN 7 28153370 missense probably benign 0.00
IGL02830:9530053A07Rik APN 7 28162923 missense probably damaging 1.00
IGL02943:9530053A07Rik APN 7 28147188 missense probably damaging 1.00
IGL02977:9530053A07Rik APN 7 28164372 missense possibly damaging 0.83
IGL03231:9530053A07Rik APN 7 28153722 missense possibly damaging 0.95
IGL03304:9530053A07Rik APN 7 28142242 missense probably damaging 0.99
PIT4378001:9530053A07Rik UTSW 7 28154464 missense possibly damaging 0.61
R0023:9530053A07Rik UTSW 7 28153412 missense probably benign 0.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0132:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0158:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R0230:9530053A07Rik UTSW 7 28156825 missense probably damaging 1.00
R0310:9530053A07Rik UTSW 7 28142274 missense probably benign 0.04
R0448:9530053A07Rik UTSW 7 28140235 missense probably benign 0.03
R0462:9530053A07Rik UTSW 7 28137340 missense probably damaging 1.00
R0481:9530053A07Rik UTSW 7 28153749 missense probably damaging 1.00
R0497:9530053A07Rik UTSW 7 28147465 missense probably damaging 1.00
R0556:9530053A07Rik UTSW 7 28159378 missense probably benign
R0562:9530053A07Rik UTSW 7 28162690 missense probably benign 0.30
R0586:9530053A07Rik UTSW 7 28137091 missense probably damaging 0.99
R0924:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R0930:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R1103:9530053A07Rik UTSW 7 28154520 missense probably damaging 1.00
R1213:9530053A07Rik UTSW 7 28157673 missense probably damaging 1.00
R1292:9530053A07Rik UTSW 7 28142794 splice site probably benign
R1368:9530053A07Rik UTSW 7 28159478 missense possibly damaging 0.89
R1451:9530053A07Rik UTSW 7 28137157 missense probably damaging 1.00
R1477:9530053A07Rik UTSW 7 28157093 missense probably benign 0.01
R1538:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R1655:9530053A07Rik UTSW 7 28147110 missense probably damaging 0.98
R1697:9530053A07Rik UTSW 7 28154347 missense probably damaging 1.00
R1741:9530053A07Rik UTSW 7 28157854 missense probably damaging 0.98
R1796:9530053A07Rik UTSW 7 28155372 missense probably damaging 1.00
R1853:9530053A07Rik UTSW 7 28155546 nonsense probably null
R1861:9530053A07Rik UTSW 7 28154732 missense probably damaging 1.00
R1909:9530053A07Rik UTSW 7 28144348 missense possibly damaging 0.52
R1971:9530053A07Rik UTSW 7 28131512 missense possibly damaging 0.90
R1990:9530053A07Rik UTSW 7 28154360 missense probably damaging 0.98
R2020:9530053A07Rik UTSW 7 28155594 missense probably benign
R2084:9530053A07Rik UTSW 7 28157535 missense probably damaging 1.00
R2125:9530053A07Rik UTSW 7 28158022 missense probably benign 0.00
R2132:9530053A07Rik UTSW 7 28155474 missense probably damaging 1.00
R2513:9530053A07Rik UTSW 7 28131635 missense probably damaging 0.99
R2913:9530053A07Rik UTSW 7 28164307 missense probably damaging 1.00
R3150:9530053A07Rik UTSW 7 28154195 missense probably benign 0.21
R3499:9530053A07Rik UTSW 7 28154555 missense probably benign 0.42
R3702:9530053A07Rik UTSW 7 28157778 missense probably damaging 1.00
R3881:9530053A07Rik UTSW 7 28140038 nonsense probably null
R3938:9530053A07Rik UTSW 7 28154294 missense probably damaging 1.00
R4050:9530053A07Rik UTSW 7 28152985 missense possibly damaging 0.55
R4152:9530053A07Rik UTSW 7 28156897 missense possibly damaging 0.47
R4168:9530053A07Rik UTSW 7 28137109 missense probably benign 0.05
R4235:9530053A07Rik UTSW 7 28156648 missense probably damaging 0.99
R4241:9530053A07Rik UTSW 7 28154335 missense probably damaging 1.00
R4363:9530053A07Rik UTSW 7 28146906 missense probably damaging 1.00
R4460:9530053A07Rik UTSW 7 28152856 missense probably benign 0.17
R4463:9530053A07Rik UTSW 7 28150719 missense probably benign
R4841:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4842:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4876:9530053A07Rik UTSW 7 28142800 intron probably benign
R4905:9530053A07Rik UTSW 7 28156983 missense possibly damaging 0.93
R4997:9530053A07Rik UTSW 7 28143924 missense possibly damaging 0.77
R5091:9530053A07Rik UTSW 7 28156958 missense probably benign 0.44
R5159:9530053A07Rik UTSW 7 28153308 missense probably benign 0.09
R5326:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5396:9530053A07Rik UTSW 7 28140183 missense probably benign
R5441:9530053A07Rik UTSW 7 28156914 missense probably damaging 1.00
R5480:9530053A07Rik UTSW 7 28157999 nonsense probably null
R5542:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5571:9530053A07Rik UTSW 7 28156569 missense probably damaging 0.99
R5613:9530053A07Rik UTSW 7 28142878 intron probably benign
R5637:9530053A07Rik UTSW 7 28152852 missense probably benign 0.00
R5766:9530053A07Rik UTSW 7 28137329 nonsense probably null
R6174:9530053A07Rik UTSW 7 28139959 missense probably damaging 0.96
R6233:9530053A07Rik UTSW 7 28131460 missense probably damaging 0.99
R6250:9530053A07Rik UTSW 7 28150714 missense probably damaging 1.00
R6379:9530053A07Rik UTSW 7 28157592 missense probably damaging 1.00
R6442:9530053A07Rik UTSW 7 28144186 missense possibly damaging 0.88
R6478:9530053A07Rik UTSW 7 28155373 missense probably damaging 1.00
R6699:9530053A07Rik UTSW 7 28144368 missense probably damaging 1.00
R6852:9530053A07Rik UTSW 7 28147135 missense probably damaging 1.00
R6883:9530053A07Rik UTSW 7 28152835 missense possibly damaging 0.89
R6902:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6903:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6904:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6992:9530053A07Rik UTSW 7 28140183 missense probably benign 0.04
R7023:9530053A07Rik UTSW 7 28140038 nonsense probably null
R7039:9530053A07Rik UTSW 7 28140148 missense possibly damaging 0.80
R7171:9530053A07Rik UTSW 7 28154519 nonsense probably null
R7282:9530053A07Rik UTSW 7 28144408 missense probably benign 0.02
R7291:9530053A07Rik UTSW 7 28140220 missense probably benign
R7344:9530053A07Rik UTSW 7 28140279 missense possibly damaging 0.79
R7344:9530053A07Rik UTSW 7 28152760 missense possibly damaging 0.46
R7392:9530053A07Rik UTSW 7 28164372 missense possibly damaging 0.83
R7541:9530053A07Rik UTSW 7 28144256 nonsense probably null
R7577:9530053A07Rik UTSW 7 28154423 missense possibly damaging 0.65
R7594:9530053A07Rik UTSW 7 28131460 missense probably damaging 0.99
R7647:9530053A07Rik UTSW 7 28140045 missense probably benign 0.00
R7718:9530053A07Rik UTSW 7 28147201 missense probably damaging 1.00
R7733:9530053A07Rik UTSW 7 28139965 missense probably damaging 1.00
R7737:9530053A07Rik UTSW 7 28157073 missense probably damaging 1.00
R7908:9530053A07Rik UTSW 7 28147496 missense probably benign 0.12
R7989:9530053A07Rik UTSW 7 28147496 missense probably benign 0.12
R8013:9530053A07Rik UTSW 7 28137541 missense probably benign 0.14
R8014:9530053A07Rik UTSW 7 28137541 missense probably benign 0.14
Z1176:9530053A07Rik UTSW 7 28142386 missense probably benign 0.06
Z1176:9530053A07Rik UTSW 7 28154762 missense probably benign 0.03
Z1177:9530053A07Rik UTSW 7 28139898 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGTCTGCCTAAGGAGCACTG -3'
(R):5'- TCGTTGAATGAATCCCACTCTG -3'

Sequencing Primer
(F):5'- CCTAAGGAGCACTGTGGGGTAC -3'
(R):5'- CTAAGGCCTCCAACTTCA -3'
Posted On2019-10-17