Mutagenetix > Incidental Mutation

Incidental Mutation 'R7531:Keap1'

583323

Institutional Source

Beutler Lab

Gene Symbol

Keap1

Ensembl Gene

ENSMUSG00000003308

Gene Name

kelch-like ECH-associated protein 1

Synonyms

INrf2, ring canal protein

MMRRC Submission

045603-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R7531 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21141026-21150628 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21148623 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 128 (I128T)

Ref Sequence

ENSEMBL: ENSMUSP00000062467 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049567] [ENSMUST00000164812] [ENSMUST00000193982] [ENSMUST00000194542] [ENSMUST00000216436]

AlphaFold

Q9Z2X8

PDB Structure

Structural basis for the defects of human lung cancer somatic mutations in the repression activity of Keap1 on Nrf2 [X-RAY DIFFRACTION]
Structural basis for the defects of human lung cancer somatic mutations in the repression activity of Keap1 on Nrf2 [X-RAY DIFFRACTION]
Crystal structure of the Keap1 protein in complexed with the N-terminal region of the Nrf2 transcription factor [X-RAY DIFFRACTION]
Crystal structure of Keap1 complexed with Prothymosin alpha [X-RAY DIFFRACTION]
Crystal Structure of Keap1 in Complex with Sequestosome-1/p62 [X-RAY DIFFRACTION]
Crystal Structure of Keap1 in Complex with phosphorylated p62 [X-RAY DIFFRACTION]
Crystal Structure of Keap1 in Complex with the N-terminal region of the Nrf2 transcription factor [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000049567
AA Change: I128T

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000062467
Gene: ENSMUSG00000003308
AA Change: I128T

Domain	Start	End	E-Value	Type
BTB	77	179	1.33e-25	SMART
BACK	184	286	2.19e-34	SMART
Kelch	327	372	4.2e-11	SMART
Kelch	373	423	4.1e-14	SMART
Kelch	424	470	5.12e-15	SMART
Kelch	471	517	1.02e-18	SMART
Kelch	518	564	1.23e-17	SMART
Kelch	565	611	7.58e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000164812
AA Change: I128T

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000131029
Gene: ENSMUSG00000003308
AA Change: I128T

Domain	Start	End	E-Value	Type
BTB	77	179	1.33e-25	SMART
BACK	184	286	2.19e-34	SMART
Kelch	327	372	4.2e-11	SMART
Kelch	373	423	4.1e-14	SMART
Kelch	424	470	5.12e-15	SMART
Kelch	471	517	1.02e-18	SMART
Kelch	518	564	1.23e-17	SMART
Kelch	565	611	7.58e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000193982
AA Change: I128T

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000141840
Gene: ENSMUSG00000003308
AA Change: I128T

Domain	Start	End	E-Value	Type
BTB	77	179	1.33e-25	SMART
BACK	184	286	2.19e-34	SMART
Kelch	327	372	4.2e-11	SMART
Kelch	373	423	4.1e-14	SMART
Kelch	424	470	5.12e-15	SMART
Kelch	471	517	1.02e-18	SMART
Kelch	518	564	1.23e-17	SMART
Kelch	565	611	7.58e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000194542
AA Change: I128T

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000141807
Gene: ENSMUSG00000003308
AA Change: I128T

Domain	Start	End	E-Value	Type
BTB	77	179	1.33e-25	SMART
BACK	184	286	2.19e-34	SMART
Kelch	327	372	4.2e-11	SMART
Kelch	373	423	4.1e-14	SMART
Kelch	424	470	5.12e-15	SMART
Kelch	471	517	1.02e-18	SMART
Kelch	518	564	1.23e-17	SMART
Kelch	565	611	7.58e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000216436
AA Change: I128T

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing KELCH-1 like domains, as well as a BTB/POZ domain. Kelch-like ECH-associated protein 1 interacts with NF-E2-related factor 2 in a redox-sensitive manner and the dissociation of the proteins in the cytoplasm is followed by transportation of NF-E2-related factor 2 to the nucleus. This interaction results in the expression of the catalytic subunit of gamma-glutamylcysteine synthetase. Two alternatively spliced transcript variants encoding the same isoform have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit scaly skin, hyperkeratosis of the esophagus and stomach mucosa, and die around 3 weeks of age, putatively due to malnutrition resulting from the abnormal alimentary epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	A	1: 71,286,332 (GRCm39)	T2501S	probably damaging	Het
Abcg3	A	G	5: 105,125,507 (GRCm39)	Y59H	probably benign	Het
Acsf2	G	T	11: 94,464,057 (GRCm39)		probably null	Het
Adam25	T	A	8: 41,206,914 (GRCm39)	I60K	probably damaging	Het
Agrn	A	T	4: 156,254,261 (GRCm39)	V1729E	probably damaging	Het
Aldh9a1	G	A	1: 167,177,895 (GRCm39)	V31I	probably benign	Het
Aqp5	T	C	15: 99,489,180 (GRCm39)	F10L	possibly damaging	Het
Arfgap2	T	A	2: 91,104,089 (GRCm39)		probably null	Het
Asb7	T	C	7: 66,328,884 (GRCm39)	H52R	probably damaging	Het
Aspa	G	A	11: 73,204,351 (GRCm39)	Q206*	probably null	Het
Bpgm	A	G	6: 34,481,223 (GRCm39)	I207V	possibly damaging	Het
Brinp2	A	G	1: 158,094,142 (GRCm39)	S187P	possibly damaging	Het
Clec4e	A	G	6: 123,262,533 (GRCm39)	F128S	probably benign	Het
Crisp3	A	G	17: 40,545,629 (GRCm39)	F82L	probably benign	Het
Cry2	A	G	2: 92,243,350 (GRCm39)	L497P	probably damaging	Het
Dcxr	A	G	11: 120,617,832 (GRCm39)	V48A	probably benign	Het
Ddx11	A	T	17: 66,445,214 (GRCm39)	T379S	probably benign	Het
Depdc1a	A	C	3: 159,228,276 (GRCm39)	T343P	probably damaging	Het
Dhx36	T	C	3: 62,392,389 (GRCm39)	I546V	probably damaging	Het
Fam114a2	A	G	11: 57,404,542 (GRCm39)	V74A	probably benign	Het
Fcgbpl1	T	C	7: 27,839,656 (GRCm39)	F490L	probably benign	Het
Flg2	A	T	3: 93,108,177 (GRCm39)	R68S	probably damaging	Het
Glb1l3	T	C	9: 26,764,950 (GRCm39)	I154V	possibly damaging	Het
Gm45844	T	C	7: 7,243,185 (GRCm39)	T22A	probably benign	Het
Gramd2a	A	T	9: 59,617,193 (GRCm39)	I83F	probably damaging	Het
Hcn4	A	G	9: 58,767,420 (GRCm39)	T994A	unknown	Het
Hectd1	C	T	12: 51,853,150 (GRCm39)	V124I	probably benign	Het
Hmcn1	A	T	1: 150,562,531 (GRCm39)	D2342E	probably benign	Het
Hyal6	A	T	6: 24,740,786 (GRCm39)	H313L	possibly damaging	Het
Ifnab	T	A	4: 88,609,523 (GRCm39)		probably benign	Het
Kit	T	C	5: 75,767,700 (GRCm39)	S28P	probably damaging	Het
Krtap5-3	T	A	7: 141,755,942 (GRCm39)	C260S	unknown	Het
Lepr	T	A	4: 101,609,372 (GRCm39)	W320R	probably damaging	Het
Lmod3	A	T	6: 97,225,403 (GRCm39)	N139K	probably benign	Het
Marchf1	C	G	8: 66,838,989 (GRCm39)	S10R	probably benign	Het
Naa35	A	T	13: 59,765,755 (GRCm39)	K380*	probably null	Het
Npy1r	C	A	8: 67,157,546 (GRCm39)	F285L	probably damaging	Het
Nr1h3	C	T	2: 91,014,739 (GRCm39)	R427H	probably damaging	Het
Or5p79	T	A	7: 108,221,269 (GRCm39)	N83K	probably benign	Het
Pate2	A	G	9: 35,582,008 (GRCm39)		probably null	Het
Pcmt1	A	G	10: 7,556,369 (GRCm39)		probably null	Het
Prg4	T	G	1: 150,330,786 (GRCm39)	E629A	unknown	Het
Rin2	T	G	2: 145,700,419 (GRCm39)	S199A	probably benign	Het
Ror1	T	A	4: 100,298,388 (GRCm39)	L587Q	probably damaging	Het
Rsl1	T	A	13: 67,324,566 (GRCm39)	C31S	possibly damaging	Het
Scn4a	A	G	11: 106,239,523 (GRCm39)		probably null	Het
Sema3a	T	C	5: 13,615,805 (GRCm39)	Y410H	probably damaging	Het
Smpd5	T	C	15: 76,180,539 (GRCm39)	V447A	probably benign	Het
Tax1bp1	A	T	6: 52,723,682 (GRCm39)	D524V	probably benign	Het
Tesc	A	T	5: 118,197,523 (GRCm39)	Y179F	probably damaging	Het
Tm9sf2	T	C	14: 122,379,824 (GRCm39)	S292P	possibly damaging	Het
Unc45b	A	G	11: 82,819,838 (GRCm39)	D543G	probably damaging	Het
Usp4	T	A	9: 108,249,879 (GRCm39)	V469E	probably damaging	Het
Vmn1r10	T	A	6: 57,090,924 (GRCm39)	I172N	possibly damaging	Het
Zfyve16	A	G	13: 92,659,473 (GRCm39)	L146S	probably damaging	Het

Other mutations in Keap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
cubs	UTSW	9	21,148,849 (GRCm39)	missense	probably benign	0.07
R1917:Keap1	UTSW	9	21,145,102 (GRCm39)	missense	probably benign
R4296:Keap1	UTSW	9	21,145,282 (GRCm39)	missense	probably damaging	1.00
R4590:Keap1	UTSW	9	21,148,905 (GRCm39)	missense	probably damaging	0.97
R4723:Keap1	UTSW	9	21,142,706 (GRCm39)	missense	probably benign	0.15
R4947:Keap1	UTSW	9	21,148,849 (GRCm39)	missense	probably benign	0.07
R4952:Keap1	UTSW	9	21,148,582 (GRCm39)	missense	probably damaging	1.00
R5024:Keap1	UTSW	9	21,148,522 (GRCm39)	missense	probably damaging	1.00
R6001:Keap1	UTSW	9	21,142,135 (GRCm39)	missense	possibly damaging	0.45
R6508:Keap1	UTSW	9	21,143,010 (GRCm39)	missense	possibly damaging	0.67
R7075:Keap1	UTSW	9	21,142,552 (GRCm39)	missense	probably benign	0.30
R7184:Keap1	UTSW	9	21,145,134 (GRCm39)	missense	probably benign
R7520:Keap1	UTSW	9	21,144,787 (GRCm39)	missense	probably benign
R7811:Keap1	UTSW	9	21,148,956 (GRCm39)	missense	possibly damaging	0.92
R8424:Keap1	UTSW	9	21,142,086 (GRCm39)	missense	probably benign	0.00
R8976:Keap1	UTSW	9	21,142,663 (GRCm39)	missense	probably damaging	1.00
R9154:Keap1	UTSW	9	21,142,121 (GRCm39)	nonsense	probably null
R9521:Keap1	UTSW	9	21,143,136 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATGTAGATATACTCCCGGGCAC -3'
(R):5'- TGAGCCAGCAACTCTGTGAC -3'

Sequencing Primer
(F):5'- AGTTCAGTGCAGCCGATCTG -3'
(R):5'- AGCAACTCTGTGACGTGAC -3'

Posted On

2019-10-17