Incidental Mutation 'R7531:Fam114a2'
ID583328
Institutional Source Beutler Lab
Gene Symbol Fam114a2
Ensembl Gene ENSMUSG00000020523
Gene Namefamily with sequence similarity 114, member A2
Synonyms1810073G14Rik, 9030624B09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R7531 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location57482993-57518617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57513716 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 74 (V74A)
Ref Sequence ENSEMBL: ENSMUSP00000104478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020830] [ENSMUST00000020831] [ENSMUST00000108849] [ENSMUST00000108850]
Predicted Effect probably benign
Transcript: ENSMUST00000020830
SMART Domains Protein: ENSMUSP00000020830
Gene: ENSMUSG00000020522

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 59 124 7.07e-13 SMART
transmembrane domain 141 163 N/A INTRINSIC
low complexity region 284 302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000020831
AA Change: V67A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000020831
Gene: ENSMUSG00000020523
AA Change: V67A

DomainStartEndE-ValueType
Pfam:DUF719 68 236 5e-72 PFAM
low complexity region 263 275 N/A INTRINSIC
low complexity region 338 355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108849
SMART Domains Protein: ENSMUSP00000104477
Gene: ENSMUSG00000020522

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 59 124 7.07e-13 SMART
transmembrane domain 141 163 N/A INTRINSIC
low complexity region 284 302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108850
AA Change: V74A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104478
Gene: ENSMUSG00000020523
AA Change: V74A

DomainStartEndE-ValueType
Pfam:DUF719 77 243 4.5e-71 PFAM
low complexity region 270 282 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,140,231 F490L probably benign Het
Abca12 T A 1: 71,247,173 T2501S probably damaging Het
Abcg3 A G 5: 104,977,641 Y59H probably benign Het
Acsf2 G T 11: 94,573,231 probably null Het
Adam25 T A 8: 40,753,877 I60K probably damaging Het
Agrn A T 4: 156,169,804 V1729E probably damaging Het
Aldh9a1 G A 1: 167,350,326 V31I probably benign Het
Aqp5 T C 15: 99,591,299 F10L possibly damaging Het
Arfgap2 T A 2: 91,273,744 probably null Het
Asb7 T C 7: 66,679,136 H52R probably damaging Het
Aspa G A 11: 73,313,525 Q206* probably null Het
Bpgm A G 6: 34,504,288 I207V possibly damaging Het
Brinp2 A G 1: 158,266,572 S187P possibly damaging Het
Clec4e A G 6: 123,285,574 F128S probably benign Het
Crisp3 A G 17: 40,234,738 F82L probably benign Het
Cry2 A G 2: 92,413,005 L497P probably damaging Het
Dcxr A G 11: 120,727,006 V48A probably benign Het
Ddx11 A T 17: 66,138,219 T379S probably benign Het
Depdc1a A C 3: 159,522,639 T343P probably damaging Het
Dhx36 T C 3: 62,484,968 I546V probably damaging Het
Flg2 A T 3: 93,200,870 R68S probably damaging Het
Glb1l3 T C 9: 26,853,654 I154V possibly damaging Het
Gm45844 T C 7: 7,240,186 T22A probably benign Het
Gramd2 A T 9: 59,709,910 I83F probably damaging Het
Hcn4 A G 9: 58,860,137 T994A unknown Het
Hectd1 C T 12: 51,806,367 V124I probably benign Het
Hmcn1 A T 1: 150,686,780 D2342E probably benign Het
Hyal6 A T 6: 24,740,787 H313L possibly damaging Het
Ifnab T A 4: 88,691,286 probably benign Het
Keap1 A G 9: 21,237,327 I128T probably benign Het
Kit T C 5: 75,607,040 S28P probably damaging Het
Krtap5-3 T A 7: 142,202,205 C260S unknown Het
Lepr T A 4: 101,752,175 W320R probably damaging Het
Lmod3 A T 6: 97,248,442 N139K probably benign Het
March1 C G 8: 66,386,337 S10R probably benign Het
Naa35 A T 13: 59,617,941 K380* probably null Het
Npy1r C A 8: 66,704,894 F285L probably damaging Het
Nr1h3 C T 2: 91,184,394 R427H probably damaging Het
Olfr507 T A 7: 108,622,062 N83K probably benign Het
Pate2 A G 9: 35,670,712 probably null Het
Pcmt1 A G 10: 7,680,605 probably null Het
Prg4 T G 1: 150,455,035 E629A unknown Het
Rin2 T G 2: 145,858,499 S199A probably benign Het
Ror1 T A 4: 100,441,191 L587Q probably damaging Het
Rsl1 T A 13: 67,176,502 C31S possibly damaging Het
Scn4a A G 11: 106,348,697 probably null Het
Sema3a T C 5: 13,565,838 Y410H probably damaging Het
Smpd5 T C 15: 76,296,339 V447A probably benign Het
Tax1bp1 A T 6: 52,746,697 D524V probably benign Het
Tesc A T 5: 118,059,458 Y179F probably damaging Het
Tm9sf2 T C 14: 122,142,412 S292P possibly damaging Het
Unc45b A G 11: 82,929,012 D543G probably damaging Het
Usp4 T A 9: 108,372,680 V469E probably damaging Het
Vmn1r10 T A 6: 57,113,939 I172N possibly damaging Het
Zfyve16 A G 13: 92,522,965 L146S probably damaging Het
Other mutations in Fam114a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Fam114a2 APN 11 57487587 missense probably damaging 1.00
IGL00943:Fam114a2 APN 11 57514273 start codon destroyed probably null 1.00
IGL01809:Fam114a2 APN 11 57513635 critical splice donor site probably null
IGL01972:Fam114a2 APN 11 57509394 missense probably damaging 1.00
IGL02541:Fam114a2 APN 11 57499801 missense probably benign 0.41
R0010:Fam114a2 UTSW 11 57514156 missense probably damaging 1.00
R1594:Fam114a2 UTSW 11 57513240 critical splice donor site probably null
R1645:Fam114a2 UTSW 11 57499795 missense probably benign 0.00
R2426:Fam114a2 UTSW 11 57493080 missense probably benign 0.00
R3021:Fam114a2 UTSW 11 57499799 missense probably benign 0.01
R3107:Fam114a2 UTSW 11 57499735 missense probably benign 0.39
R6149:Fam114a2 UTSW 11 57487589 missense probably benign 0.05
R6248:Fam114a2 UTSW 11 57493116 missense possibly damaging 0.51
R6306:Fam114a2 UTSW 11 57514146 missense probably damaging 1.00
R6933:Fam114a2 UTSW 11 57484071 missense probably benign 0.04
R7485:Fam114a2 UTSW 11 57513689 missense probably damaging 1.00
R7486:Fam114a2 UTSW 11 57513689 missense probably damaging 1.00
R7487:Fam114a2 UTSW 11 57513689 missense probably damaging 1.00
R7601:Fam114a2 UTSW 11 57514216 missense possibly damaging 0.62
R7662:Fam114a2 UTSW 11 57507565 missense probably damaging 1.00
R8033:Fam114a2 UTSW 11 57507507 missense probably damaging 0.99
RF024:Fam114a2 UTSW 11 57493033 missense probably benign 0.00
Z1177:Fam114a2 UTSW 11 57513258 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGCTTAGATGAATCCCTAGACTTCAAC -3'
(R):5'- TGATGCAGCAATGCCTTTATC -3'

Sequencing Primer
(F):5'- CTTCCTAATAGAGCATGACATGAGC -3'
(R):5'- CATTTGCTGCAGGGTATTTATACGC -3'
Posted On2019-10-17