Incidental Mutation 'R7531:Naa35'
ID583333
Institutional Source Beutler Lab
Gene Symbol Naa35
Ensembl Gene ENSMUSG00000021555
Gene NameN(alpha)-acetyltransferase 35, NatC auxiliary subunit
SynonymsMak10, A330021G12Rik, C030004C14Rik, A330027C19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R7531 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location59585259-59635922 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 59617941 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 380 (K380*)
Ref Sequence ENSEMBL: ENSMUSP00000022038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022038] [ENSMUST00000164011] [ENSMUST00000165253] [ENSMUST00000172419]
Predicted Effect probably null
Transcript: ENSMUST00000022038
AA Change: K380*
SMART Domains Protein: ENSMUSP00000022038
Gene: ENSMUSG00000021555
AA Change: K380*

DomainStartEndE-ValueType
Pfam:Mak10 45 145 2.2e-29 PFAM
Pfam:Mak10 141 194 3.7e-10 PFAM
low complexity region 561 568 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164011
SMART Domains Protein: ENSMUSP00000127270
Gene: ENSMUSG00000021555

DomainStartEndE-ValueType
Pfam:Mak10 1 119 1.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165253
Predicted Effect probably null
Transcript: ENSMUST00000172166
AA Change: K118*
Predicted Effect probably null
Transcript: ENSMUST00000172419
AA Change: K348*
SMART Domains Protein: ENSMUSP00000126079
Gene: ENSMUSG00000021555
AA Change: K348*

DomainStartEndE-ValueType
Pfam:Mak10 40 193 1.2e-55 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,140,231 F490L probably benign Het
Abca12 T A 1: 71,247,173 T2501S probably damaging Het
Abcg3 A G 5: 104,977,641 Y59H probably benign Het
Acsf2 G T 11: 94,573,231 probably null Het
Adam25 T A 8: 40,753,877 I60K probably damaging Het
Agrn A T 4: 156,169,804 V1729E probably damaging Het
Aldh9a1 G A 1: 167,350,326 V31I probably benign Het
Aqp5 T C 15: 99,591,299 F10L possibly damaging Het
Arfgap2 T A 2: 91,273,744 probably null Het
Asb7 T C 7: 66,679,136 H52R probably damaging Het
Aspa G A 11: 73,313,525 Q206* probably null Het
Bpgm A G 6: 34,504,288 I207V possibly damaging Het
Brinp2 A G 1: 158,266,572 S187P possibly damaging Het
Clec4e A G 6: 123,285,574 F128S probably benign Het
Crisp3 A G 17: 40,234,738 F82L probably benign Het
Cry2 A G 2: 92,413,005 L497P probably damaging Het
Dcxr A G 11: 120,727,006 V48A probably benign Het
Ddx11 A T 17: 66,138,219 T379S probably benign Het
Depdc1a A C 3: 159,522,639 T343P probably damaging Het
Dhx36 T C 3: 62,484,968 I546V probably damaging Het
Fam114a2 A G 11: 57,513,716 V74A probably benign Het
Flg2 A T 3: 93,200,870 R68S probably damaging Het
Glb1l3 T C 9: 26,853,654 I154V possibly damaging Het
Gm45844 T C 7: 7,240,186 T22A probably benign Het
Gramd2 A T 9: 59,709,910 I83F probably damaging Het
Hcn4 A G 9: 58,860,137 T994A unknown Het
Hectd1 C T 12: 51,806,367 V124I probably benign Het
Hmcn1 A T 1: 150,686,780 D2342E probably benign Het
Hyal6 A T 6: 24,740,787 H313L possibly damaging Het
Ifnab T A 4: 88,691,286 probably benign Het
Keap1 A G 9: 21,237,327 I128T probably benign Het
Kit T C 5: 75,607,040 S28P probably damaging Het
Krtap5-3 T A 7: 142,202,205 C260S unknown Het
Lepr T A 4: 101,752,175 W320R probably damaging Het
Lmod3 A T 6: 97,248,442 N139K probably benign Het
March1 C G 8: 66,386,337 S10R probably benign Het
Npy1r C A 8: 66,704,894 F285L probably damaging Het
Nr1h3 C T 2: 91,184,394 R427H probably damaging Het
Olfr507 T A 7: 108,622,062 N83K probably benign Het
Pate2 A G 9: 35,670,712 probably null Het
Pcmt1 A G 10: 7,680,605 probably null Het
Prg4 T G 1: 150,455,035 E629A unknown Het
Rin2 T G 2: 145,858,499 S199A probably benign Het
Ror1 T A 4: 100,441,191 L587Q probably damaging Het
Rsl1 T A 13: 67,176,502 C31S possibly damaging Het
Scn4a A G 11: 106,348,697 probably null Het
Sema3a T C 5: 13,565,838 Y410H probably damaging Het
Smpd5 T C 15: 76,296,339 V447A probably benign Het
Tax1bp1 A T 6: 52,746,697 D524V probably benign Het
Tesc A T 5: 118,059,458 Y179F probably damaging Het
Tm9sf2 T C 14: 122,142,412 S292P possibly damaging Het
Unc45b A G 11: 82,929,012 D543G probably damaging Het
Usp4 T A 9: 108,372,680 V469E probably damaging Het
Vmn1r10 T A 6: 57,113,939 I172N possibly damaging Het
Zfyve16 A G 13: 92,522,965 L146S probably damaging Het
Other mutations in Naa35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Naa35 APN 13 59630055 missense probably damaging 1.00
IGL00743:Naa35 APN 13 59630671 missense probably benign 0.33
IGL01335:Naa35 APN 13 59616796 missense probably damaging 1.00
IGL01385:Naa35 APN 13 59601066 missense probably damaging 1.00
IGL01541:Naa35 APN 13 59600963 missense probably damaging 1.00
IGL02129:Naa35 APN 13 59609525 missense probably damaging 0.99
IGL02867:Naa35 APN 13 59608854 intron probably benign
IGL02966:Naa35 APN 13 59586271 missense probably benign
IGL03260:Naa35 APN 13 59627885 missense probably benign 0.05
R0312:Naa35 UTSW 13 59609581 missense probably benign 0.01
R0557:Naa35 UTSW 13 59627964 missense probably damaging 0.99
R1553:Naa35 UTSW 13 59618279 critical splice donor site probably null
R1611:Naa35 UTSW 13 59628933 missense probably benign 0.01
R1676:Naa35 UTSW 13 59612676 missense probably damaging 1.00
R3709:Naa35 UTSW 13 59618032 splice site probably benign
R3896:Naa35 UTSW 13 59607295 missense probably damaging 1.00
R5001:Naa35 UTSW 13 59625531 missense possibly damaging 0.75
R5647:Naa35 UTSW 13 59622866 unclassified probably benign
R5649:Naa35 UTSW 13 59622866 unclassified probably benign
R5650:Naa35 UTSW 13 59622866 unclassified probably benign
R5656:Naa35 UTSW 13 59622866 unclassified probably benign
R6734:Naa35 UTSW 13 59608191 missense possibly damaging 0.83
R6735:Naa35 UTSW 13 59625564 missense probably damaging 1.00
R6985:Naa35 UTSW 13 59627943 missense probably benign 0.03
R7165:Naa35 UTSW 13 59586183 missense probably benign 0.05
R7713:Naa35 UTSW 13 59598105 missense probably benign 0.01
R7739:Naa35 UTSW 13 59599784 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAAATTTATGAACAAGCGAC -3'
(R):5'- ACTGGTCCTGAGAGGTCTTC -3'

Sequencing Primer
(F):5'- GTGTGGTGCACAGACATACATTC -3'
(R):5'- CCTGAGAGGTCTTCATCTACAGAG -3'
Posted On2019-10-17