Incidental Mutation 'R7532:Itgb6'
ID583348
Institutional Source Beutler Lab
Gene Symbol Itgb6
Ensembl Gene ENSMUSG00000026971
Gene Nameintegrin beta 6
Synonyms4831415H04Rik, 2210409C20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R7532 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location60598292-60722643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 60669213 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 79 (V79I)
Ref Sequence ENSEMBL: ENSMUSP00000028348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028348] [ENSMUST00000059888] [ENSMUST00000112517] [ENSMUST00000154764]
Predicted Effect probably benign
Transcript: ENSMUST00000028348
AA Change: V79I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028348
Gene: ENSMUSG00000026971
AA Change: V79I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.59e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 776 7.82e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059888
AA Change: V79I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054944
Gene: ENSMUSG00000026971
AA Change: V79I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.59e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 776 7.82e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112517
AA Change: V79I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108136
Gene: ENSMUSG00000026971
AA Change: V79I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.81e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 759 2.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154764
AA Change: V79I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117815
Gene: ENSMUSG00000026971
AA Change: V79I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PSI 22 71 2.19e-9 SMART
INB 30 454 1.84e-277 SMART
VWA 132 365 1.11e-1 SMART
internal_repeat_1 484 538 1.62e-8 PROSPERO
EGF_like 543 575 6.15e1 SMART
Integrin_B_tail 624 706 1.07e-19 SMART
Integrin_b_cyt 730 755 2.3e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the integrin superfamily. Members of this family are adhesion receptors that function in signaling from the extracellular matrix to the cell. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. The encoded protein forms a dimer with an alpha v chain and this heterodimer can bind to ligands like fibronectin and transforming growth factor beta 1. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit baldness associated with macrophage infiltration of skin, exaggerated pulmonary inflammation, and an impaired mucosal mast cell response to nematode infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 T A 19: 53,232,158 I174K probably damaging Het
Ano2 A T 6: 125,963,704 I597F probably damaging Het
Ap1g1 T C 8: 109,860,164 V813A probably damaging Het
Bpnt1 A T 1: 185,352,326 I207F possibly damaging Het
Brinp3 T A 1: 146,901,401 W529R probably damaging Het
C2cd2l C T 9: 44,315,384 R355Q probably benign Het
Ccser1 T A 6: 62,379,931 C784* probably null Het
Cdh7 A T 1: 110,138,159 D721V probably damaging Het
Chd9 A G 8: 90,994,565 I994V unknown Het
Cst13 T G 2: 148,823,207 Y41D probably benign Het
Cyth2 C T 7: 45,808,024 A342T probably benign Het
Dapk1 T C 13: 60,730,886 L563P probably damaging Het
Dclk3 T G 9: 111,467,528 S47A probably benign Het
Dync1h1 C A 12: 110,651,577 N3183K probably benign Het
Enpp1 C T 10: 24,675,987 V165M probably benign Het
Ephx3 T C 17: 32,188,789 N173S possibly damaging Het
Erc1 T A 6: 119,779,631 D388V probably benign Het
Esp34 T G 17: 38,559,620 V135G possibly damaging Het
Gfy G A 7: 45,178,037 P212S probably damaging Het
Gm5239 C T 18: 35,536,742 R54C probably benign Het
Gtpbp3 T C 8: 71,489,463 F113L probably benign Het
Hectd1 T A 12: 51,790,450 D775V probably damaging Het
Ifrd2 T G 9: 107,592,522 S431R probably damaging Het
Impg2 G A 16: 56,267,180 A1121T probably damaging Het
Irx1 A G 13: 71,960,195 F123L possibly damaging Het
Kcnd3 G A 3: 105,668,210 R550H probably damaging Het
Klhl9 A T 4: 88,720,853 S384T possibly damaging Het
Kng2 T C 16: 23,027,044 probably null Het
Lipo3 T C 19: 33,583,064 N67S possibly damaging Het
Mgst1 T C 6: 138,153,506 S78P probably benign Het
Ms4a14 A G 19: 11,303,959 Y412H possibly damaging Het
Mucl2 A C 15: 103,896,052 I124S unknown Het
Myh3 A G 11: 67,091,095 M806V probably benign Het
Nelfcd T C 2: 174,426,396 L501P probably damaging Het
Nlrp6 C A 7: 140,925,184 P748Q probably benign Het
Olfr341 C T 2: 36,480,126 M1I probably null Het
Olfr430 T C 1: 174,070,098 S267P probably benign Het
Plxna2 G A 1: 194,644,819 A354T probably benign Het
Prpf39 G T 12: 65,053,371 V273L probably benign Het
Rad9a T C 19: 4,201,523 probably benign Het
Rnf135 A G 11: 80,198,906 D356G probably benign Het
Rragd G T 4: 33,004,166 A153S possibly damaging Het
Selenot G T 3: 58,585,232 V47L probably benign Het
Smc2 T C 4: 52,451,013 L277P probably damaging Het
Sp7 A G 15: 102,359,149 F92S possibly damaging Het
Spata1 A T 3: 146,468,191 I380N possibly damaging Het
Spdye4b G T 5: 143,194,897 R39S possibly damaging Het
Stom C A 2: 35,321,577 R144L possibly damaging Het
Tex37 T C 6: 70,913,637 K57R probably benign Het
Tsc22d1 T C 14: 76,416,046 probably benign Het
Unc13b A G 4: 43,249,565 T998A probably benign Het
Vcl C A 14: 21,029,324 A965D probably damaging Het
Vmn1r69 A T 7: 10,580,354 V150D probably damaging Het
Vmn1r90 T G 7: 14,561,264 N303T possibly damaging Het
Vmn2r69 A T 7: 85,410,414 M429K probably benign Het
Vmn2r8 T A 5: 108,802,240 Y247F probably benign Het
Washc5 A T 15: 59,367,411 S168T possibly damaging Het
Other mutations in Itgb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Itgb6 APN 2 60620352 missense probably benign 0.07
IGL01363:Itgb6 APN 2 60611382 missense possibly damaging 0.89
IGL01810:Itgb6 APN 2 60627985 missense probably benign 0.19
IGL02026:Itgb6 APN 2 60628066 missense possibly damaging 0.79
IGL02347:Itgb6 APN 2 60611412 missense probably benign
R0372:Itgb6 UTSW 2 60627841 missense probably benign 0.28
R0533:Itgb6 UTSW 2 60669197 missense probably benign 0.22
R0542:Itgb6 UTSW 2 60605136 missense possibly damaging 0.53
R1037:Itgb6 UTSW 2 60650068 missense probably damaging 1.00
R1191:Itgb6 UTSW 2 60653137 splice site probably null
R1775:Itgb6 UTSW 2 60672644 nonsense probably null
R1802:Itgb6 UTSW 2 60653281 missense probably benign 0.22
R1934:Itgb6 UTSW 2 60669149 missense probably benign 0.05
R2847:Itgb6 UTSW 2 60600535 missense probably damaging 1.00
R3934:Itgb6 UTSW 2 60611411 missense possibly damaging 0.89
R5603:Itgb6 UTSW 2 60620362 missense probably benign 0.03
R6255:Itgb6 UTSW 2 60605276 missense probably damaging 1.00
R6571:Itgb6 UTSW 2 60628456 missense probably damaging 1.00
R6908:Itgb6 UTSW 2 60650021 missense probably benign 0.02
R7010:Itgb6 UTSW 2 60649978 missense probably damaging 1.00
R7212:Itgb6 UTSW 2 60634654 missense probably damaging 0.99
R7259:Itgb6 UTSW 2 60650011 missense probably damaging 1.00
R7300:Itgb6 UTSW 2 60605306 missense probably benign 0.04
R7491:Itgb6 UTSW 2 60620376 missense probably damaging 1.00
R7861:Itgb6 UTSW 2 60628444 missense probably damaging 1.00
R7944:Itgb6 UTSW 2 60628444 missense probably damaging 1.00
R7955:Itgb6 UTSW 2 60649860 intron probably null
R8086:Itgb6 UTSW 2 60650032 missense probably damaging 0.98
X0018:Itgb6 UTSW 2 60672666 missense possibly damaging 0.88
Z1088:Itgb6 UTSW 2 60620211 missense probably null 1.00
Z1176:Itgb6 UTSW 2 60611468 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGTGCCAGAGGGATTATCAG -3'
(R):5'- ATCACCACCAGTCGTGTAGG -3'

Sequencing Primer
(F):5'- TTATCAGAAGGCAAGGCACAGAC -3'
(R):5'- CACCAGTCGTGTAGGGGATG -3'
Posted On2019-10-17