Incidental Mutation 'R7532:Klhl9'
ID583357
Institutional Source Beutler Lab
Gene Symbol Klhl9
Ensembl Gene ENSMUSG00000070923
Gene Namekelch-like 9
SynonymsC530050O22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7532 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location88718292-88722465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88720853 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 384 (S384T)
Ref Sequence ENSEMBL: ENSMUSP00000092602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094993] [ENSMUST00000181601]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094993
AA Change: S384T

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092602
Gene: ENSMUSG00000070923
AA Change: S384T

DomainStartEndE-ValueType
BTB 50 149 7.21e-22 SMART
BACK 154 255 3.93e-27 SMART
low complexity region 276 287 N/A INTRINSIC
Kelch 299 347 1.13e-2 SMART
Kelch 348 399 1.92e-5 SMART
Kelch 400 446 1.59e-11 SMART
Kelch 447 493 2.61e-7 SMART
Kelch 494 545 1.58e-6 SMART
Kelch 546 594 1.43e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181601
SMART Domains Protein: ENSMUSP00000137773
Gene: ENSMUSG00000097078

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the kelch repeat-containing family, and contains an N-terminal BTB/POZ domain, a BACK domain and six C-terminal kelch repeats. The encoded protein is a component of a complex with cullin 3-based E3 ligase, which plays a role in mitosis. This protein complex is a cell cycle regulator, and functions in the organization and integrity of the spindle midzone in anaphase and the completion of cytokinesis. The complex is required for the removal of the chromosomal passenger protein aurora B from mitotic chromosomes. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 T A 19: 53,232,158 I174K probably damaging Het
Ano2 A T 6: 125,963,704 I597F probably damaging Het
Ap1g1 T C 8: 109,860,164 V813A probably damaging Het
Bpnt1 A T 1: 185,352,326 I207F possibly damaging Het
Brinp3 T A 1: 146,901,401 W529R probably damaging Het
C2cd2l C T 9: 44,315,384 R355Q probably benign Het
Ccser1 T A 6: 62,379,931 C784* probably null Het
Cdh7 A T 1: 110,138,159 D721V probably damaging Het
Chd9 A G 8: 90,994,565 I994V unknown Het
Cst13 T G 2: 148,823,207 Y41D probably benign Het
Cyth2 C T 7: 45,808,024 A342T probably benign Het
Dapk1 T C 13: 60,730,886 L563P probably damaging Het
Dclk3 T G 9: 111,467,528 S47A probably benign Het
Dync1h1 C A 12: 110,651,577 N3183K probably benign Het
Enpp1 C T 10: 24,675,987 V165M probably benign Het
Ephx3 T C 17: 32,188,789 N173S possibly damaging Het
Erc1 T A 6: 119,779,631 D388V probably benign Het
Esp34 T G 17: 38,559,620 V135G possibly damaging Het
Gfy G A 7: 45,178,037 P212S probably damaging Het
Gm5239 C T 18: 35,536,742 R54C probably benign Het
Gtpbp3 T C 8: 71,489,463 F113L probably benign Het
Hectd1 T A 12: 51,790,450 D775V probably damaging Het
Ifrd2 T G 9: 107,592,522 S431R probably damaging Het
Impg2 G A 16: 56,267,180 A1121T probably damaging Het
Irx1 A G 13: 71,960,195 F123L possibly damaging Het
Itgb6 C T 2: 60,669,213 V79I probably benign Het
Kcnd3 G A 3: 105,668,210 R550H probably damaging Het
Kng2 T C 16: 23,027,044 probably null Het
Lipo3 T C 19: 33,583,064 N67S possibly damaging Het
Mgst1 T C 6: 138,153,506 S78P probably benign Het
Ms4a14 A G 19: 11,303,959 Y412H possibly damaging Het
Mucl2 A C 15: 103,896,052 I124S unknown Het
Myh3 A G 11: 67,091,095 M806V probably benign Het
Nelfcd T C 2: 174,426,396 L501P probably damaging Het
Nlrp6 C A 7: 140,925,184 P748Q probably benign Het
Olfr341 C T 2: 36,480,126 M1I probably null Het
Olfr430 T C 1: 174,070,098 S267P probably benign Het
Plxna2 G A 1: 194,644,819 A354T probably benign Het
Prpf39 G T 12: 65,053,371 V273L probably benign Het
Rad9a T C 19: 4,201,523 probably benign Het
Rnf135 A G 11: 80,198,906 D356G probably benign Het
Rragd G T 4: 33,004,166 A153S possibly damaging Het
Selenot G T 3: 58,585,232 V47L probably benign Het
Smc2 T C 4: 52,451,013 L277P probably damaging Het
Sp7 A G 15: 102,359,149 F92S possibly damaging Het
Spata1 A T 3: 146,468,191 I380N possibly damaging Het
Spdye4b G T 5: 143,194,897 R39S possibly damaging Het
Stom C A 2: 35,321,577 R144L possibly damaging Het
Tex37 T C 6: 70,913,637 K57R probably benign Het
Tsc22d1 T C 14: 76,416,046 probably benign Het
Unc13b A G 4: 43,249,565 T998A probably benign Het
Vcl C A 14: 21,029,324 A965D probably damaging Het
Vmn1r69 A T 7: 10,580,354 V150D probably damaging Het
Vmn1r90 T G 7: 14,561,264 N303T possibly damaging Het
Vmn2r69 A T 7: 85,410,414 M429K probably benign Het
Vmn2r8 T A 5: 108,802,240 Y247F probably benign Het
Washc5 A T 15: 59,367,411 S168T possibly damaging Het
Other mutations in Klhl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Klhl9 APN 4 88720819 missense probably damaging 1.00
IGL00592:Klhl9 APN 4 88721141 missense probably damaging 0.99
IGL01986:Klhl9 APN 4 88721779 missense probably damaging 0.99
IGL02364:Klhl9 APN 4 88721170 missense probably damaging 1.00
IGL02994:Klhl9 APN 4 88721197 nonsense probably null
minnow UTSW 4 88721606 nonsense probably null
R0319:Klhl9 UTSW 4 88720454 missense possibly damaging 0.91
R0360:Klhl9 UTSW 4 88720290 missense probably benign 0.05
R0364:Klhl9 UTSW 4 88720290 missense probably benign 0.05
R0693:Klhl9 UTSW 4 88720290 missense probably benign 0.05
R0961:Klhl9 UTSW 4 88721737 missense probably benign 0.16
R1521:Klhl9 UTSW 4 88721993 missense probably benign 0.03
R2891:Klhl9 UTSW 4 88720970 missense probably benign 0.02
R3762:Klhl9 UTSW 4 88721593 missense possibly damaging 0.93
R4584:Klhl9 UTSW 4 88721907 missense probably damaging 1.00
R4678:Klhl9 UTSW 4 88720924 missense probably damaging 1.00
R4888:Klhl9 UTSW 4 88721945 missense probably benign 0.01
R5030:Klhl9 UTSW 4 88720534 missense possibly damaging 0.96
R5082:Klhl9 UTSW 4 88721385 missense probably damaging 0.97
R6466:Klhl9 UTSW 4 88721162 missense probably benign 0.00
R7032:Klhl9 UTSW 4 88721606 nonsense probably null
R7602:Klhl9 UTSW 4 88722409 start gained probably benign
R7618:Klhl9 UTSW 4 88720535 missense possibly damaging 0.80
R7879:Klhl9 UTSW 4 88720338 missense probably damaging 1.00
R7909:Klhl9 UTSW 4 88721001 missense probably benign 0.12
R7962:Klhl9 UTSW 4 88720338 missense probably damaging 1.00
R7990:Klhl9 UTSW 4 88721001 missense probably benign 0.12
X0063:Klhl9 UTSW 4 88721951 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCATGAGTGATTCCTCCGG -3'
(R):5'- CAGGAGTGGAAGTCGTTAGC -3'

Sequencing Primer
(F):5'- CATATACTGTTCCAGCATGGCCATAG -3'
(R):5'- AAGTCGTTAGCGCCCATG -3'
Posted On2019-10-17