Incidental Mutation 'R7532:Vmn2r8'
ID 583358
Institutional Source Beutler Lab
Gene Symbol Vmn2r8
Ensembl Gene ENSMUSG00000090961
Gene Name vomeronasal 2, receptor 8
Synonyms EG627479
MMRRC Submission 045604-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R7532 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 108945059-108956620 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 108950106 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 247 (Y247F)
Ref Sequence ENSEMBL: ENSMUSP00000126953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172140]
AlphaFold L7N472
Predicted Effect probably benign
Transcript: ENSMUST00000172140
AA Change: Y247F

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126953
Gene: ENSMUSG00000090961
AA Change: Y247F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 419 1.1e-28 PFAM
Pfam:NCD3G 507 561 8.2e-18 PFAM
Pfam:7tm_3 594 829 1.1e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 T A 19: 53,220,589 (GRCm39) I174K probably damaging Het
Ano2 A T 6: 125,940,667 (GRCm39) I597F probably damaging Het
Ap1g1 T C 8: 110,586,796 (GRCm39) V813A probably damaging Het
Bpnt1 A T 1: 185,084,523 (GRCm39) I207F possibly damaging Het
Brinp3 T A 1: 146,777,139 (GRCm39) W529R probably damaging Het
C2cd2l C T 9: 44,226,681 (GRCm39) R355Q probably benign Het
Ccser1 T A 6: 62,356,915 (GRCm39) C784* probably null Het
Cdh20 A T 1: 110,065,889 (GRCm39) D721V probably damaging Het
Chd9 A G 8: 91,721,193 (GRCm39) I994V unknown Het
Cst13 T G 2: 148,665,127 (GRCm39) Y41D probably benign Het
Cyth2 C T 7: 45,457,448 (GRCm39) A342T probably benign Het
Dapk1 T C 13: 60,878,700 (GRCm39) L563P probably damaging Het
Dclk3 T G 9: 111,296,596 (GRCm39) S47A probably benign Het
Dync1h1 C A 12: 110,618,011 (GRCm39) N3183K probably benign Het
Enpp1 C T 10: 24,551,885 (GRCm39) V165M probably benign Het
Ephx3 T C 17: 32,407,763 (GRCm39) N173S possibly damaging Het
Erc1 T A 6: 119,756,592 (GRCm39) D388V probably benign Het
Esp34 T G 17: 38,870,511 (GRCm39) V135G possibly damaging Het
Gfy G A 7: 44,827,461 (GRCm39) P212S probably damaging Het
Gm5239 C T 18: 35,669,795 (GRCm39) R54C probably benign Het
Gtpbp3 T C 8: 71,942,107 (GRCm39) F113L probably benign Het
Hectd1 T A 12: 51,837,233 (GRCm39) D775V probably damaging Het
Ifrd2 T G 9: 107,469,721 (GRCm39) S431R probably damaging Het
Impg2 G A 16: 56,087,543 (GRCm39) A1121T probably damaging Het
Irx1 A G 13: 72,108,314 (GRCm39) F123L possibly damaging Het
Itgb6 C T 2: 60,499,557 (GRCm39) V79I probably benign Het
Kcnd3 G A 3: 105,575,526 (GRCm39) R550H probably damaging Het
Klhl9 A T 4: 88,639,090 (GRCm39) S384T possibly damaging Het
Kng2 T C 16: 22,845,794 (GRCm39) probably null Het
Lipo3 T C 19: 33,560,464 (GRCm39) N67S possibly damaging Het
Mgst1 T C 6: 138,130,504 (GRCm39) S78P probably benign Het
Ms4a14 A G 19: 11,281,323 (GRCm39) Y412H possibly damaging Het
Mucl2 A C 15: 103,926,318 (GRCm39) I124S unknown Het
Myh3 A G 11: 66,981,921 (GRCm39) M806V probably benign Het
Nelfcd T C 2: 174,268,189 (GRCm39) L501P probably damaging Het
Nlrp6 C A 7: 140,505,097 (GRCm39) P748Q probably benign Het
Or1j13 C T 2: 36,370,138 (GRCm39) M1I probably null Het
Or6n2 T C 1: 173,897,664 (GRCm39) S267P probably benign Het
Plxna2 G A 1: 194,327,127 (GRCm39) A354T probably benign Het
Prpf39 G T 12: 65,100,145 (GRCm39) V273L probably benign Het
Rad9a T C 19: 4,251,522 (GRCm39) probably benign Het
Rnf135 A G 11: 80,089,732 (GRCm39) D356G probably benign Het
Rragd G T 4: 33,004,166 (GRCm39) A153S possibly damaging Het
Selenot G T 3: 58,492,653 (GRCm39) V47L probably benign Het
Smc2 T C 4: 52,451,013 (GRCm39) L277P probably damaging Het
Sp7 A G 15: 102,267,584 (GRCm39) F92S possibly damaging Het
Spata1 A T 3: 146,173,946 (GRCm39) I380N possibly damaging Het
Spdye4b G T 5: 143,180,652 (GRCm39) R39S possibly damaging Het
Spmip9 T C 6: 70,890,621 (GRCm39) K57R probably benign Het
Stom C A 2: 35,211,589 (GRCm39) R144L possibly damaging Het
Tsc22d1 T C 14: 76,653,486 (GRCm39) probably benign Het
Unc13b A G 4: 43,249,565 (GRCm39) T998A probably benign Het
Vcl C A 14: 21,079,392 (GRCm39) A965D probably damaging Het
Vmn1r69 A T 7: 10,314,281 (GRCm39) V150D probably damaging Het
Vmn1r90 T G 7: 14,295,189 (GRCm39) N303T possibly damaging Het
Vmn2r69 A T 7: 85,059,622 (GRCm39) M429K probably benign Het
Washc5 A T 15: 59,239,260 (GRCm39) S168T possibly damaging Het
Other mutations in Vmn2r8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02957:Vmn2r8 APN 5 108,950,091 (GRCm39) missense probably benign 0.01
R0324:Vmn2r8 UTSW 5 108,945,807 (GRCm39) splice site probably null
R0335:Vmn2r8 UTSW 5 108,945,317 (GRCm39) splice site probably null
R0394:Vmn2r8 UTSW 5 108,949,938 (GRCm39) missense probably benign 0.12
R0501:Vmn2r8 UTSW 5 108,951,049 (GRCm39) missense probably benign 0.03
R0615:Vmn2r8 UTSW 5 108,947,195 (GRCm39) missense probably damaging 1.00
R0678:Vmn2r8 UTSW 5 108,948,412 (GRCm39) missense probably benign 0.00
R1167:Vmn2r8 UTSW 5 108,951,042 (GRCm39) missense probably benign 0.01
R1187:Vmn2r8 UTSW 5 108,951,085 (GRCm39) nonsense probably null
R1406:Vmn2r8 UTSW 5 108,950,234 (GRCm39) missense probably benign
R1406:Vmn2r8 UTSW 5 108,950,234 (GRCm39) missense probably benign
R1451:Vmn2r8 UTSW 5 108,945,933 (GRCm39) missense probably damaging 1.00
R1535:Vmn2r8 UTSW 5 108,950,040 (GRCm39) missense probably damaging 1.00
R1795:Vmn2r8 UTSW 5 108,950,972 (GRCm39) missense probably benign
R1874:Vmn2r8 UTSW 5 108,950,284 (GRCm39) missense possibly damaging 0.74
R1908:Vmn2r8 UTSW 5 108,945,436 (GRCm39) missense probably benign 0.03
R1925:Vmn2r8 UTSW 5 108,950,019 (GRCm39) missense probably damaging 0.97
R1960:Vmn2r8 UTSW 5 108,947,152 (GRCm39) missense probably damaging 0.99
R1961:Vmn2r8 UTSW 5 108,945,961 (GRCm39) missense probably benign 0.45
R1967:Vmn2r8 UTSW 5 108,950,249 (GRCm39) missense probably benign 0.01
R2095:Vmn2r8 UTSW 5 108,956,487 (GRCm39) missense possibly damaging 0.94
R2159:Vmn2r8 UTSW 5 108,950,169 (GRCm39) missense probably benign 0.22
R4240:Vmn2r8 UTSW 5 108,945,369 (GRCm39) missense probably damaging 0.99
R4581:Vmn2r8 UTSW 5 108,949,570 (GRCm39) missense probably benign 0.03
R4744:Vmn2r8 UTSW 5 108,956,447 (GRCm39) missense probably benign 0.00
R4755:Vmn2r8 UTSW 5 108,949,566 (GRCm39) missense probably benign 0.03
R4917:Vmn2r8 UTSW 5 108,945,264 (GRCm39) missense probably damaging 1.00
R4957:Vmn2r8 UTSW 5 108,947,129 (GRCm39) missense probably benign 0.16
R5141:Vmn2r8 UTSW 5 108,956,572 (GRCm39) missense probably damaging 0.96
R5481:Vmn2r8 UTSW 5 108,949,636 (GRCm39) missense probably benign 0.09
R5571:Vmn2r8 UTSW 5 108,950,106 (GRCm39) missense probably damaging 1.00
R5624:Vmn2r8 UTSW 5 108,950,325 (GRCm39) missense probably damaging 0.99
R6003:Vmn2r8 UTSW 5 108,945,248 (GRCm39) missense probably damaging 1.00
R6243:Vmn2r8 UTSW 5 108,947,211 (GRCm39) missense probably benign 0.01
R6265:Vmn2r8 UTSW 5 108,956,463 (GRCm39) missense probably benign
R6315:Vmn2r8 UTSW 5 108,949,757 (GRCm39) missense probably benign
R6413:Vmn2r8 UTSW 5 108,949,589 (GRCm39) missense probably benign 0.09
R7120:Vmn2r8 UTSW 5 108,956,504 (GRCm39) missense possibly damaging 0.56
R7406:Vmn2r8 UTSW 5 108,948,442 (GRCm39) missense probably benign 0.00
R7409:Vmn2r8 UTSW 5 108,956,449 (GRCm39) nonsense probably null
R7489:Vmn2r8 UTSW 5 108,945,522 (GRCm39) missense possibly damaging 0.95
R7534:Vmn2r8 UTSW 5 108,950,040 (GRCm39) missense possibly damaging 0.94
R7739:Vmn2r8 UTSW 5 108,950,043 (GRCm39) missense probably damaging 1.00
R8099:Vmn2r8 UTSW 5 108,949,700 (GRCm39) missense probably benign
R8245:Vmn2r8 UTSW 5 108,945,936 (GRCm39) missense probably damaging 1.00
R8711:Vmn2r8 UTSW 5 108,945,962 (GRCm39) missense possibly damaging 0.89
R8781:Vmn2r8 UTSW 5 108,945,597 (GRCm39) missense possibly damaging 0.95
R8874:Vmn2r8 UTSW 5 108,956,617 (GRCm39) missense probably damaging 1.00
R8927:Vmn2r8 UTSW 5 108,950,131 (GRCm39) missense
R8928:Vmn2r8 UTSW 5 108,950,131 (GRCm39) missense
R9288:Vmn2r8 UTSW 5 108,950,185 (GRCm39) missense probably benign 0.39
R9596:Vmn2r8 UTSW 5 108,947,196 (GRCm39) missense possibly damaging 0.94
R9652:Vmn2r8 UTSW 5 108,951,107 (GRCm39) missense probably benign 0.18
Z1088:Vmn2r8 UTSW 5 108,949,864 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGTGGTGTTCAAAAGTAACAGTC -3'
(R):5'- ACATACTTGTCCCATGCCATG -3'

Sequencing Primer
(F):5'- GTGTTCAAAAGTAACAGTCCCATGG -3'
(R):5'- ATGCCATGGTCTCCTTGATG -3'
Posted On 2019-10-17