Incidental Mutation 'R7532:Ccser1'
ID583360
Institutional Source Beutler Lab
Gene Symbol Ccser1
Ensembl Gene ENSMUSG00000039578
Gene Namecoiled-coil serine rich 1
Synonyms6230405M12Rik, C130092O11Rik, Fam190a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R7532 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location61180324-62382865 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 62379931 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 784 (C784*)
Ref Sequence ENSEMBL: ENSMUSP00000040251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045522] [ENSMUST00000126214] [ENSMUST00000232648]
Predicted Effect probably null
Transcript: ENSMUST00000045522
AA Change: C784*
SMART Domains Protein: ENSMUSP00000040251
Gene: ENSMUSG00000039578
AA Change: C784*

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126214
AA Change: C784*
SMART Domains Protein: ENSMUSP00000122894
Gene: ENSMUSG00000039578
AA Change: C784*

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000232648
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 T A 19: 53,232,158 I174K probably damaging Het
Ano2 A T 6: 125,963,704 I597F probably damaging Het
Ap1g1 T C 8: 109,860,164 V813A probably damaging Het
Bpnt1 A T 1: 185,352,326 I207F possibly damaging Het
Brinp3 T A 1: 146,901,401 W529R probably damaging Het
C2cd2l C T 9: 44,315,384 R355Q probably benign Het
Cdh7 A T 1: 110,138,159 D721V probably damaging Het
Chd9 A G 8: 90,994,565 I994V unknown Het
Cst13 T G 2: 148,823,207 Y41D probably benign Het
Cyth2 C T 7: 45,808,024 A342T probably benign Het
Dapk1 T C 13: 60,730,886 L563P probably damaging Het
Dclk3 T G 9: 111,467,528 S47A probably benign Het
Dync1h1 C A 12: 110,651,577 N3183K probably benign Het
Enpp1 C T 10: 24,675,987 V165M probably benign Het
Ephx3 T C 17: 32,188,789 N173S possibly damaging Het
Erc1 T A 6: 119,779,631 D388V probably benign Het
Esp34 T G 17: 38,559,620 V135G possibly damaging Het
Gfy G A 7: 45,178,037 P212S probably damaging Het
Gm5239 C T 18: 35,536,742 R54C probably benign Het
Gtpbp3 T C 8: 71,489,463 F113L probably benign Het
Hectd1 T A 12: 51,790,450 D775V probably damaging Het
Ifrd2 T G 9: 107,592,522 S431R probably damaging Het
Impg2 G A 16: 56,267,180 A1121T probably damaging Het
Irx1 A G 13: 71,960,195 F123L possibly damaging Het
Itgb6 C T 2: 60,669,213 V79I probably benign Het
Kcnd3 G A 3: 105,668,210 R550H probably damaging Het
Klhl9 A T 4: 88,720,853 S384T possibly damaging Het
Kng2 T C 16: 23,027,044 probably null Het
Lipo3 T C 19: 33,583,064 N67S possibly damaging Het
Mgst1 T C 6: 138,153,506 S78P probably benign Het
Ms4a14 A G 19: 11,303,959 Y412H possibly damaging Het
Mucl2 A C 15: 103,896,052 I124S unknown Het
Myh3 A G 11: 67,091,095 M806V probably benign Het
Nelfcd T C 2: 174,426,396 L501P probably damaging Het
Nlrp6 C A 7: 140,925,184 P748Q probably benign Het
Olfr341 C T 2: 36,480,126 M1I probably null Het
Olfr430 T C 1: 174,070,098 S267P probably benign Het
Plxna2 G A 1: 194,644,819 A354T probably benign Het
Prpf39 G T 12: 65,053,371 V273L probably benign Het
Rad9a T C 19: 4,201,523 probably benign Het
Rnf135 A G 11: 80,198,906 D356G probably benign Het
Rragd G T 4: 33,004,166 A153S possibly damaging Het
Selenot G T 3: 58,585,232 V47L probably benign Het
Smc2 T C 4: 52,451,013 L277P probably damaging Het
Sp7 A G 15: 102,359,149 F92S possibly damaging Het
Spata1 A T 3: 146,468,191 I380N possibly damaging Het
Spdye4b G T 5: 143,194,897 R39S possibly damaging Het
Stom C A 2: 35,321,577 R144L possibly damaging Het
Tex37 T C 6: 70,913,637 K57R probably benign Het
Tsc22d1 T C 14: 76,416,046 probably benign Het
Unc13b A G 4: 43,249,565 T998A probably benign Het
Vcl C A 14: 21,029,324 A965D probably damaging Het
Vmn1r69 A T 7: 10,580,354 V150D probably damaging Het
Vmn1r90 T G 7: 14,561,264 N303T possibly damaging Het
Vmn2r69 A T 7: 85,410,414 M429K probably benign Het
Vmn2r8 T A 5: 108,802,240 Y247F probably benign Het
Washc5 A T 15: 59,367,411 S168T possibly damaging Het
Other mutations in Ccser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ccser1 APN 6 62380142 missense possibly damaging 0.80
IGL00858:Ccser1 APN 6 61810665 nonsense probably null
IGL01012:Ccser1 APN 6 61638490 missense probably benign 0.01
IGL01391:Ccser1 APN 6 61638521 splice site probably benign
IGL01643:Ccser1 APN 6 61311855 missense probably benign 0.01
IGL01767:Ccser1 APN 6 61718152 missense probably benign 0.03
IGL02081:Ccser1 APN 6 61311168 nonsense probably null
IGL02152:Ccser1 APN 6 61311708 missense possibly damaging 0.57
IGL02870:Ccser1 APN 6 61311292 missense probably damaging 0.99
IGL02890:Ccser1 APN 6 62379831 missense probably damaging 0.99
IGL03147:Ccser1 UTSW 6 61312160 missense probably benign 0.02
R0020:Ccser1 UTSW 6 61313804 missense possibly damaging 0.62
R0831:Ccser1 UTSW 6 61423061 missense probably damaging 0.99
R1306:Ccser1 UTSW 6 62380106 missense probably damaging 0.99
R1441:Ccser1 UTSW 6 62380032 missense probably benign 0.00
R1650:Ccser1 UTSW 6 61638490 missense probably benign 0.01
R1653:Ccser1 UTSW 6 61311465 missense probably benign 0.00
R1913:Ccser1 UTSW 6 62379894 missense probably damaging 0.99
R1961:Ccser1 UTSW 6 61313646 splice site probably benign
R2030:Ccser1 UTSW 6 61311563 missense probably benign
R2056:Ccser1 UTSW 6 61422952 splice site probably null
R2268:Ccser1 UTSW 6 61570843 missense probably damaging 1.00
R2280:Ccser1 UTSW 6 61570815 missense probably damaging 1.00
R2281:Ccser1 UTSW 6 61570815 missense probably damaging 1.00
R2571:Ccser1 UTSW 6 61422960 missense probably damaging 1.00
R4606:Ccser1 UTSW 6 61311584 missense probably damaging 0.99
R4711:Ccser1 UTSW 6 61311926 missense possibly damaging 0.74
R4770:Ccser1 UTSW 6 61311501 missense possibly damaging 0.85
R4932:Ccser1 UTSW 6 61718191 missense possibly damaging 0.78
R5078:Ccser1 UTSW 6 61311366 missense probably damaging 0.97
R5097:Ccser1 UTSW 6 61312160 missense probably benign 0.02
R5221:Ccser1 UTSW 6 61312091 missense probably damaging 0.99
R5378:Ccser1 UTSW 6 61311666 missense probably benign 0.00
R5604:Ccser1 UTSW 6 61313804 missense probably damaging 0.97
R5700:Ccser1 UTSW 6 61311276 missense probably benign 0.00
R5970:Ccser1 UTSW 6 61311242 missense possibly damaging 0.94
R6257:Ccser1 UTSW 6 61373962 missense probably damaging 0.96
R6257:Ccser1 UTSW 6 62379785 missense probably benign
R6375:Ccser1 UTSW 6 61311168 nonsense probably null
R6703:Ccser1 UTSW 6 61638511 nonsense probably null
R6930:Ccser1 UTSW 6 62380025 missense probably benign 0.03
R7256:Ccser1 UTSW 6 61311867 missense probably benign 0.38
R7362:Ccser1 UTSW 6 61810880 missense unknown
R7508:Ccser1 UTSW 6 61570723 missense probably benign 0.05
R7533:Ccser1 UTSW 6 61638490 missense probably benign 0.25
R7729:Ccser1 UTSW 6 61311856 missense probably benign
R7875:Ccser1 UTSW 6 61311948 missense probably benign 0.06
R7958:Ccser1 UTSW 6 61311948 missense probably benign 0.06
R8055:Ccser1 UTSW 6 61313773 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- GCTTCAGGTTTGTACATAAGGG -3'
(R):5'- TTCTGAGAACATGGGCAGC -3'

Sequencing Primer
(F):5'- CAGGACACTGTAAGATGGTTTTTC -3'
(R):5'- TGAGAACATGGGCAGCCCTTC -3'
Posted On2019-10-17