Incidental Mutation 'R7532:Vmn1r69'
ID583365
Institutional Source Beutler Lab
Gene Symbol Vmn1r69
Ensembl Gene ENSMUSG00000091662
Gene Namevomeronasal 1 receptor 69
SynonymsV1re9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7532 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location10578930-10613659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10580354 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 150 (V150D)
Ref Sequence ENSEMBL: ENSMUSP00000134993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163658] [ENSMUST00000176284] [ENSMUST00000176707] [ENSMUST00000226160] [ENSMUST00000226190] [ENSMUST00000226228] [ENSMUST00000227853] [ENSMUST00000228296] [ENSMUST00000228478] [ENSMUST00000228638]
Predicted Effect probably damaging
Transcript: ENSMUST00000163658
AA Change: V150D

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129646
Gene: ENSMUSG00000091662
AA Change: V150D

DomainStartEndE-ValueType
Pfam:V1R 50 307 3.3e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176284
AA Change: V150D

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000176707
AA Change: V150D

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000226160
AA Change: V150D

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000226190
AA Change: V150D

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000226228
AA Change: V150D

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227853
AA Change: V71D

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228296
AA Change: V71D

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228478
AA Change: V71D

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228638
AA Change: V71D

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 T A 19: 53,232,158 I174K probably damaging Het
Ano2 A T 6: 125,963,704 I597F probably damaging Het
Ap1g1 T C 8: 109,860,164 V813A probably damaging Het
Bpnt1 A T 1: 185,352,326 I207F possibly damaging Het
Brinp3 T A 1: 146,901,401 W529R probably damaging Het
C2cd2l C T 9: 44,315,384 R355Q probably benign Het
Ccser1 T A 6: 62,379,931 C784* probably null Het
Cdh7 A T 1: 110,138,159 D721V probably damaging Het
Chd9 A G 8: 90,994,565 I994V unknown Het
Cst13 T G 2: 148,823,207 Y41D probably benign Het
Cyth2 C T 7: 45,808,024 A342T probably benign Het
Dapk1 T C 13: 60,730,886 L563P probably damaging Het
Dclk3 T G 9: 111,467,528 S47A probably benign Het
Dync1h1 C A 12: 110,651,577 N3183K probably benign Het
Enpp1 C T 10: 24,675,987 V165M probably benign Het
Ephx3 T C 17: 32,188,789 N173S possibly damaging Het
Erc1 T A 6: 119,779,631 D388V probably benign Het
Esp34 T G 17: 38,559,620 V135G possibly damaging Het
Gfy G A 7: 45,178,037 P212S probably damaging Het
Gm5239 C T 18: 35,536,742 R54C probably benign Het
Gtpbp3 T C 8: 71,489,463 F113L probably benign Het
Hectd1 T A 12: 51,790,450 D775V probably damaging Het
Ifrd2 T G 9: 107,592,522 S431R probably damaging Het
Impg2 G A 16: 56,267,180 A1121T probably damaging Het
Irx1 A G 13: 71,960,195 F123L possibly damaging Het
Itgb6 C T 2: 60,669,213 V79I probably benign Het
Kcnd3 G A 3: 105,668,210 R550H probably damaging Het
Klhl9 A T 4: 88,720,853 S384T possibly damaging Het
Kng2 T C 16: 23,027,044 probably null Het
Lipo3 T C 19: 33,583,064 N67S possibly damaging Het
Mgst1 T C 6: 138,153,506 S78P probably benign Het
Ms4a14 A G 19: 11,303,959 Y412H possibly damaging Het
Mucl2 A C 15: 103,896,052 I124S unknown Het
Myh3 A G 11: 67,091,095 M806V probably benign Het
Nelfcd T C 2: 174,426,396 L501P probably damaging Het
Nlrp6 C A 7: 140,925,184 P748Q probably benign Het
Olfr341 C T 2: 36,480,126 M1I probably null Het
Olfr430 T C 1: 174,070,098 S267P probably benign Het
Plxna2 G A 1: 194,644,819 A354T probably benign Het
Prpf39 G T 12: 65,053,371 V273L probably benign Het
Rad9a T C 19: 4,201,523 probably benign Het
Rnf135 A G 11: 80,198,906 D356G probably benign Het
Rragd G T 4: 33,004,166 A153S possibly damaging Het
Selenot G T 3: 58,585,232 V47L probably benign Het
Smc2 T C 4: 52,451,013 L277P probably damaging Het
Sp7 A G 15: 102,359,149 F92S possibly damaging Het
Spata1 A T 3: 146,468,191 I380N possibly damaging Het
Spdye4b G T 5: 143,194,897 R39S possibly damaging Het
Stom C A 2: 35,321,577 R144L possibly damaging Het
Tex37 T C 6: 70,913,637 K57R probably benign Het
Tsc22d1 T C 14: 76,416,046 probably benign Het
Unc13b A G 4: 43,249,565 T998A probably benign Het
Vcl C A 14: 21,029,324 A965D probably damaging Het
Vmn1r90 T G 7: 14,561,264 N303T possibly damaging Het
Vmn2r69 A T 7: 85,410,414 M429K probably benign Het
Vmn2r8 T A 5: 108,802,240 Y247F probably benign Het
Washc5 A T 15: 59,367,411 S168T possibly damaging Het
Other mutations in Vmn1r69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Vmn1r69 APN 7 10579952 missense probably benign 0.00
IGL01972:Vmn1r69 APN 7 10580659 nonsense probably null
IGL02339:Vmn1r69 APN 7 10580718 nonsense probably null
IGL02424:Vmn1r69 APN 7 10580658 missense probably benign 0.00
IGL02602:Vmn1r69 APN 7 10579974 missense probably benign 0.14
IGL03271:Vmn1r69 APN 7 10580669 missense probably benign 0.11
R0034:Vmn1r69 UTSW 7 10580811 intron probably benign
R0052:Vmn1r69 UTSW 7 10580400 missense probably benign 0.00
R0096:Vmn1r69 UTSW 7 10580058 missense probably damaging 1.00
R0539:Vmn1r69 UTSW 7 10580947 splice site probably benign
R0604:Vmn1r69 UTSW 7 10580654 missense probably benign 0.00
R1681:Vmn1r69 UTSW 7 10580252 missense probably benign 0.06
R1884:Vmn1r69 UTSW 7 10580751 missense probably benign 0.00
R3741:Vmn1r69 UTSW 7 10580142 missense possibly damaging 0.47
R4655:Vmn1r69 UTSW 7 10580099 missense probably benign 0.03
R4735:Vmn1r69 UTSW 7 10580999 utr 5 prime probably benign
R4758:Vmn1r69 UTSW 7 10580546 missense probably benign 0.00
R5582:Vmn1r69 UTSW 7 10580508 missense probably damaging 1.00
R5966:Vmn1r69 UTSW 7 10580790 missense probably benign 0.00
R5977:Vmn1r69 UTSW 7 10580490 missense probably damaging 1.00
R6458:Vmn1r69 UTSW 7 10580438 missense probably benign
R6987:Vmn1r69 UTSW 7 10580564 start codon destroyed probably null 0.99
R7133:Vmn1r69 UTSW 7 10581068 intron probably benign
R7878:Vmn1r69 UTSW 7 10580790 missense probably benign 0.00
R7961:Vmn1r69 UTSW 7 10580790 missense probably benign 0.00
Z1176:Vmn1r69 UTSW 7 10580096 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TCATGGAGCCACTGGAATAGG -3'
(R):5'- ACACAATGGCAGCTTTTGG -3'

Sequencing Primer
(F):5'- CCACTGGAATAGGTGATGAGCAC -3'
(R):5'- CACACTTATTAAATGATTTGGGATGC -3'
Posted On2019-10-17