Mutagenetix > Incidental Mutation

Incidental Mutation 'R7532:Nlrp6'

583370

Institutional Source

Beutler Lab

Gene Symbol

Nlrp6

Ensembl Gene

ENSMUSG00000038745

Gene Name

NLR family, pyrin domain containing 6

Synonyms

Nalp6

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R7532 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

140920902-140929192 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 140925184 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 748 (P748Q)

Ref Sequence

ENSEMBL: ENSMUSP00000139170 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106045] [ENSMUST00000183845] [ENSMUST00000184560]

AlphaFold

Q91WS2

Predicted Effect

probably benign
Transcript: ENSMUST00000106045
AA Change: P731Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000101660
Gene: ENSMUSG00000038745
AA Change: P731Q

Domain	Start	End	E-Value	Type
PYRIN	15	96	5.44e-27	SMART
low complexity region	158	169	N/A	INTRINSIC
Pfam:NACHT	194	363	8.6e-44	PFAM
coiled coil region	590	617	N/A	INTRINSIC
low complexity region	675	697	N/A	INTRINSIC
internal_repeat_1	715	763	9.43e-6	PROSPERO
internal_repeat_1	828	876	9.43e-6	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000183845
AA Change: P718Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000139357
Gene: ENSMUSG00000038745
AA Change: P718Q

Domain	Start	End	E-Value	Type
PYRIN	15	96	5.44e-27	SMART
low complexity region	158	169	N/A	INTRINSIC
Pfam:NACHT	194	363	5.5e-43	PFAM
coiled coil region	590	617	N/A	INTRINSIC
low complexity region	680	694	N/A	INTRINSIC
internal_repeat_1	702	750	1.26e-5	PROSPERO
internal_repeat_1	815	863	1.26e-5	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000184560
AA Change: P748Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000139170
Gene: ENSMUSG00000038745
AA Change: P748Q

Domain	Start	End	E-Value	Type
PYRIN	45	126	5.44e-27	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:NACHT	224	393	8.2e-43	PFAM
coiled coil region	620	647	N/A	INTRINSIC
low complexity region	710	724	N/A	INTRINSIC
internal_repeat_1	732	780	1.55e-5	PROSPERO
internal_repeat_1	845	893	1.55e-5	PROSPERO

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene binds arginine-vasopressin and may be involved in the arginine-vasopressin-mediated regulation of renal salt-water balance. The encoded protein also mediates inflammatory responses in the colon to allow recovery from intestinal epithelial damage and protects against tumorigenesis and the development of colitis. Finally, this protein can increase activation of NF-kappa-B, activation of CASP1 through interaction with ASC, and cAMP accumulation. [provided by RefSeq, Feb 2013]
PHENOTYPE: Nullizygous mutations lead to altered colonic microbiota, increased susceptibility to induced colitis and/or inflammation-associated colon tumorigenesis. Homozygotes for a null allele show lower blood pressure and sex-specific changes in urine concentrating ability, cognition, and anxiety behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Add3	T	A	19: 53,232,158	I174K	probably damaging	Het
Ano2	A	T	6: 125,963,704	I597F	probably damaging	Het
Ap1g1	T	C	8: 109,860,164	V813A	probably damaging	Het
Bpnt1	A	T	1: 185,352,326	I207F	possibly damaging	Het
Brinp3	T	A	1: 146,901,401	W529R	probably damaging	Het
C2cd2l	C	T	9: 44,315,384	R355Q	probably benign	Het
Ccser1	T	A	6: 62,379,931	C784*	probably null	Het
Cdh7	A	T	1: 110,138,159	D721V	probably damaging	Het
Chd9	A	G	8: 90,994,565	I994V	unknown	Het
Cst13	T	G	2: 148,823,207	Y41D	probably benign	Het
Cyth2	C	T	7: 45,808,024	A342T	probably benign	Het
Dapk1	T	C	13: 60,730,886	L563P	probably damaging	Het
Dclk3	T	G	9: 111,467,528	S47A	probably benign	Het
Dync1h1	C	A	12: 110,651,577	N3183K	probably benign	Het
Enpp1	C	T	10: 24,675,987	V165M	probably benign	Het
Ephx3	T	C	17: 32,188,789	N173S	possibly damaging	Het
Erc1	T	A	6: 119,779,631	D388V	probably benign	Het
Esp34	T	G	17: 38,559,620	V135G	possibly damaging	Het
Gfy	G	A	7: 45,178,037	P212S	probably damaging	Het
Gm5239	C	T	18: 35,536,742	R54C	probably benign	Het
Gtpbp3	T	C	8: 71,489,463	F113L	probably benign	Het
Hectd1	T	A	12: 51,790,450	D775V	probably damaging	Het
Ifrd2	T	G	9: 107,592,522	S431R	probably damaging	Het
Impg2	G	A	16: 56,267,180	A1121T	probably damaging	Het
Irx1	A	G	13: 71,960,195	F123L	possibly damaging	Het
Itgb6	C	T	2: 60,669,213	V79I	probably benign	Het
Kcnd3	G	A	3: 105,668,210	R550H	probably damaging	Het
Klhl9	A	T	4: 88,720,853	S384T	possibly damaging	Het
Kng2	T	C	16: 23,027,044		probably null	Het
Lipo3	T	C	19: 33,583,064	N67S	possibly damaging	Het
Mgst1	T	C	6: 138,153,506	S78P	probably benign	Het
Ms4a14	A	G	19: 11,303,959	Y412H	possibly damaging	Het
Mucl2	A	C	15: 103,896,052	I124S	unknown	Het
Myh3	A	G	11: 67,091,095	M806V	probably benign	Het
Nelfcd	T	C	2: 174,426,396	L501P	probably damaging	Het
Olfr341	C	T	2: 36,480,126	M1I	probably null	Het
Olfr430	T	C	1: 174,070,098	S267P	probably benign	Het
Plxna2	G	A	1: 194,644,819	A354T	probably benign	Het
Prpf39	G	T	12: 65,053,371	V273L	probably benign	Het
Rad9a	T	C	19: 4,201,523		probably benign	Het
Rnf135	A	G	11: 80,198,906	D356G	probably benign	Het
Rragd	G	T	4: 33,004,166	A153S	possibly damaging	Het
Selenot	G	T	3: 58,585,232	V47L	probably benign	Het
Smc2	T	C	4: 52,451,013	L277P	probably damaging	Het
Sp7	A	G	15: 102,359,149	F92S	possibly damaging	Het
Spata1	A	T	3: 146,468,191	I380N	possibly damaging	Het
Spdye4b	G	T	5: 143,194,897	R39S	possibly damaging	Het
Stom	C	A	2: 35,321,577	R144L	possibly damaging	Het
Tex37	T	C	6: 70,913,637	K57R	probably benign	Het
Tsc22d1	T	C	14: 76,416,046		probably benign	Het
Unc13b	A	G	4: 43,249,565	T998A	probably benign	Het
Vcl	C	A	14: 21,029,324	A965D	probably damaging	Het
Vmn1r69	A	T	7: 10,580,354	V150D	probably damaging	Het
Vmn1r90	T	G	7: 14,561,264	N303T	possibly damaging	Het
Vmn2r69	A	T	7: 85,410,414	M429K	probably benign	Het
Vmn2r8	T	A	5: 108,802,240	Y247F	probably benign	Het
Washc5	A	T	15: 59,367,411	S168T	possibly damaging	Het

Other mutations in Nlrp6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Nlrp6	APN	7	140923124	missense	probably damaging	1.00
IGL01066:Nlrp6	APN	7	140921796	missense	possibly damaging	0.88
IGL01966:Nlrp6	APN	7	140925190	missense	probably damaging	1.00
IGL02625:Nlrp6	APN	7	140923500	missense	probably benign	0.00
IGL02792:Nlrp6	APN	7	140922435	missense	probably damaging	0.97
IGL02813:Nlrp6	APN	7	140923420	missense	possibly damaging	0.86
IGL03140:Nlrp6	APN	7	140927487	missense	probably benign	0.01
R0608:Nlrp6	UTSW	7	140923486	nonsense	probably null
R1404:Nlrp6	UTSW	7	140924113	small deletion	probably benign
R1404:Nlrp6	UTSW	7	140924113	small deletion	probably benign
R1472:Nlrp6	UTSW	7	140923495	missense	probably damaging	1.00
R1587:Nlrp6	UTSW	7	140923046	missense	probably damaging	1.00
R1843:Nlrp6	UTSW	7	140923093	missense	probably damaging	1.00
R1959:Nlrp6	UTSW	7	140924113	small deletion	probably benign
R2097:Nlrp6	UTSW	7	140923204	missense	probably damaging	1.00
R2118:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2119:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2120:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2121:Nlrp6	UTSW	7	140926444	missense	probably benign	0.11
R2290:Nlrp6	UTSW	7	140922163	missense	probably damaging	1.00
R3546:Nlrp6	UTSW	7	140926769	missense	probably benign	0.00
R3547:Nlrp6	UTSW	7	140926769	missense	probably benign	0.00
R3970:Nlrp6	UTSW	7	140921655	missense	probably damaging	1.00
R4483:Nlrp6	UTSW	7	140921781	missense	probably damaging	1.00
R4484:Nlrp6	UTSW	7	140921781	missense	probably damaging	1.00
R4869:Nlrp6	UTSW	7	140924093	missense	probably damaging	1.00
R4962:Nlrp6	UTSW	7	140923584	missense	probably damaging	0.99
R5436:Nlrp6	UTSW	7	140922717	nonsense	probably null
R5442:Nlrp6	UTSW	7	140922190	missense	probably benign	0.01
R5924:Nlrp6	UTSW	7	140923490	missense	probably damaging	1.00
R5936:Nlrp6	UTSW	7	140922812	nonsense	probably null
R6124:Nlrp6	UTSW	7	140923247	missense	probably damaging	1.00
R6455:Nlrp6	UTSW	7	140927509	missense	possibly damaging	0.65
R6480:Nlrp6	UTSW	7	140927443	missense	possibly damaging	0.93
R6873:Nlrp6	UTSW	7	140923520	missense	probably benign	0.01
R7061:Nlrp6	UTSW	7	140922867	missense	probably benign	0.36
R7350:Nlrp6	UTSW	7	140921278	start gained	probably benign
R7752:Nlrp6	UTSW	7	140927440	missense	possibly damaging	0.92
R7901:Nlrp6	UTSW	7	140927440	missense	possibly damaging	0.92
R8098:Nlrp6	UTSW	7	140923255	missense	probably damaging	1.00
R8381:Nlrp6	UTSW	7	140923841	missense	possibly damaging	0.47
R8513:Nlrp6	UTSW	7	140922830	missense	possibly damaging	0.83
R9114:Nlrp6	UTSW	7	140926419	missense	probably damaging	1.00
V7732:Nlrp6	UTSW	7	140926648	splice site	probably benign
Z1176:Nlrp6	UTSW	7	140922721	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACACCAGGATAACGGCAGG -3'
(R):5'- AACCACTGTTGCTTTCTCGG -3'

Sequencing Primer
(F):5'- ATAACGGCAGGACCTGGTC -3'
(R):5'- AAAGGCTGTGCTGCACTCTG -3'

Posted On

2019-10-17