Incidental Mutation 'R7532:Gtpbp3'
ID583371
Institutional Source Beutler Lab
Gene Symbol Gtpbp3
Ensembl Gene ENSMUSG00000007610
Gene NameGTP binding protein 3
Synonyms2410009F13Rik, Gtpbp3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.926) question?
Stock #R7532 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location71488103-71499583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71489463 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 113 (F113L)
Ref Sequence ENSEMBL: ENSMUSP00000007754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007754] [ENSMUST00000093450] [ENSMUST00000095259] [ENSMUST00000127741] [ENSMUST00000150969] [ENSMUST00000168847] [ENSMUST00000213382]
Predicted Effect probably benign
Transcript: ENSMUST00000007754
AA Change: F113L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000007754
Gene: ENSMUSG00000007610
AA Change: F113L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 1.8e-36 PFAM
Pfam:FeoB_N 250 390 3.9e-6 PFAM
Pfam:MMR_HSR1 251 375 1.6e-18 PFAM
Pfam:GTPase_Cys_C 421 489 9.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093450
SMART Domains Protein: ENSMUSP00000091157
Gene: ENSMUSG00000034863

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
Pfam:Anoctamin 237 874 3e-149 PFAM
coiled coil region 881 919 N/A INTRINSIC
low complexity region 948 964 N/A INTRINSIC
low complexity region 974 988 N/A INTRINSIC
low complexity region 1042 1056 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095259
AA Change: F113L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000092892
Gene: ENSMUSG00000007610
AA Change: F113L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 4.1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127741
AA Change: F113L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000123082
Gene: ENSMUSG00000007610
AA Change: F113L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 2.2e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150969
AA Change: F113L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000114193
Gene: ENSMUSG00000007610
AA Change: F113L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 152 1.8e-36 PFAM
Pfam:FeoB_N 250 390 3.9e-6 PFAM
Pfam:MMR_HSR1 251 375 1.6e-18 PFAM
Pfam:GTPase_Cys_C 421 489 9.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168847
AA Change: F114L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126761
Gene: ENSMUSG00000007610
AA Change: F114L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:TrmE_N 35 153 3e-35 PFAM
Pfam:MnmE_helical 156 490 2e-48 PFAM
Pfam:FeoB_N 251 390 1.5e-7 PFAM
Pfam:MMR_HSR1 252 376 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213382
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a GTP-binding protein. The encoded protein is localized to the mitochondria and may play a role in mitochondrial tRNA modification. Polymorphisms at this locus may be associated with severity of aminoglycoside-induced deafness, a disease associated with a mutation in the 12S rRNA. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 T A 19: 53,232,158 I174K probably damaging Het
Ano2 A T 6: 125,963,704 I597F probably damaging Het
Ap1g1 T C 8: 109,860,164 V813A probably damaging Het
Bpnt1 A T 1: 185,352,326 I207F possibly damaging Het
Brinp3 T A 1: 146,901,401 W529R probably damaging Het
C2cd2l C T 9: 44,315,384 R355Q probably benign Het
Ccser1 T A 6: 62,379,931 C784* probably null Het
Cdh7 A T 1: 110,138,159 D721V probably damaging Het
Chd9 A G 8: 90,994,565 I994V unknown Het
Cst13 T G 2: 148,823,207 Y41D probably benign Het
Cyth2 C T 7: 45,808,024 A342T probably benign Het
Dapk1 T C 13: 60,730,886 L563P probably damaging Het
Dclk3 T G 9: 111,467,528 S47A probably benign Het
Dync1h1 C A 12: 110,651,577 N3183K probably benign Het
Enpp1 C T 10: 24,675,987 V165M probably benign Het
Ephx3 T C 17: 32,188,789 N173S possibly damaging Het
Erc1 T A 6: 119,779,631 D388V probably benign Het
Esp34 T G 17: 38,559,620 V135G possibly damaging Het
Gfy G A 7: 45,178,037 P212S probably damaging Het
Gm5239 C T 18: 35,536,742 R54C probably benign Het
Hectd1 T A 12: 51,790,450 D775V probably damaging Het
Ifrd2 T G 9: 107,592,522 S431R probably damaging Het
Impg2 G A 16: 56,267,180 A1121T probably damaging Het
Irx1 A G 13: 71,960,195 F123L possibly damaging Het
Itgb6 C T 2: 60,669,213 V79I probably benign Het
Kcnd3 G A 3: 105,668,210 R550H probably damaging Het
Klhl9 A T 4: 88,720,853 S384T possibly damaging Het
Kng2 T C 16: 23,027,044 probably null Het
Lipo3 T C 19: 33,583,064 N67S possibly damaging Het
Mgst1 T C 6: 138,153,506 S78P probably benign Het
Ms4a14 A G 19: 11,303,959 Y412H possibly damaging Het
Mucl2 A C 15: 103,896,052 I124S unknown Het
Myh3 A G 11: 67,091,095 M806V probably benign Het
Nelfcd T C 2: 174,426,396 L501P probably damaging Het
Nlrp6 C A 7: 140,925,184 P748Q probably benign Het
Olfr341 C T 2: 36,480,126 M1I probably null Het
Olfr430 T C 1: 174,070,098 S267P probably benign Het
Plxna2 G A 1: 194,644,819 A354T probably benign Het
Prpf39 G T 12: 65,053,371 V273L probably benign Het
Rad9a T C 19: 4,201,523 probably benign Het
Rnf135 A G 11: 80,198,906 D356G probably benign Het
Rragd G T 4: 33,004,166 A153S possibly damaging Het
Selenot G T 3: 58,585,232 V47L probably benign Het
Smc2 T C 4: 52,451,013 L277P probably damaging Het
Sp7 A G 15: 102,359,149 F92S possibly damaging Het
Spata1 A T 3: 146,468,191 I380N possibly damaging Het
Spdye4b G T 5: 143,194,897 R39S possibly damaging Het
Stom C A 2: 35,321,577 R144L possibly damaging Het
Tex37 T C 6: 70,913,637 K57R probably benign Het
Tsc22d1 T C 14: 76,416,046 probably benign Het
Unc13b A G 4: 43,249,565 T998A probably benign Het
Vcl C A 14: 21,029,324 A965D probably damaging Het
Vmn1r69 A T 7: 10,580,354 V150D probably damaging Het
Vmn1r90 T G 7: 14,561,264 N303T possibly damaging Het
Vmn2r69 A T 7: 85,410,414 M429K probably benign Het
Vmn2r8 T A 5: 108,802,240 Y247F probably benign Het
Washc5 A T 15: 59,367,411 S168T possibly damaging Het
Other mutations in Gtpbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Gtpbp3 APN 8 71490434 missense probably damaging 1.00
IGL02476:Gtpbp3 APN 8 71492598 missense probably damaging 1.00
IGL02669:Gtpbp3 APN 8 71490902 missense probably damaging 1.00
IGL02885:Gtpbp3 APN 8 71489420 unclassified probably benign
IGL03038:Gtpbp3 APN 8 71489303 missense possibly damaging 0.94
R0267:Gtpbp3 UTSW 8 71491497 missense probably damaging 1.00
R0442:Gtpbp3 UTSW 8 71491491 missense probably damaging 0.97
R0639:Gtpbp3 UTSW 8 71492735 missense probably damaging 1.00
R0673:Gtpbp3 UTSW 8 71492735 missense probably damaging 1.00
R1844:Gtpbp3 UTSW 8 71492628 missense probably benign 0.05
R1957:Gtpbp3 UTSW 8 71490455 missense probably damaging 1.00
R2996:Gtpbp3 UTSW 8 71489496 missense possibly damaging 0.69
R3703:Gtpbp3 UTSW 8 71492135 missense probably benign 0.00
R3705:Gtpbp3 UTSW 8 71492135 missense probably benign 0.00
R4084:Gtpbp3 UTSW 8 71490512 missense probably benign 0.00
R4181:Gtpbp3 UTSW 8 71491467 missense probably damaging 1.00
R4705:Gtpbp3 UTSW 8 71491114 missense probably benign 0.23
R5081:Gtpbp3 UTSW 8 71490382 missense probably damaging 1.00
R5260:Gtpbp3 UTSW 8 71489418 unclassified probably benign
R5619:Gtpbp3 UTSW 8 71491048 intron probably benign
R5844:Gtpbp3 UTSW 8 71492555 missense probably benign 0.01
R6666:Gtpbp3 UTSW 8 71490938 missense possibly damaging 0.61
R7092:Gtpbp3 UTSW 8 71492265 missense probably benign
R7295:Gtpbp3 UTSW 8 71489495 missense possibly damaging 0.81
R7657:Gtpbp3 UTSW 8 71491121 missense probably benign
R7948:Gtpbp3 UTSW 8 71492586 missense probably damaging 1.00
R8094:Gtpbp3 UTSW 8 71488836 missense possibly damaging 0.52
R8138:Gtpbp3 UTSW 8 71492598 missense probably damaging 1.00
X0013:Gtpbp3 UTSW 8 71492693 missense possibly damaging 0.77
X0021:Gtpbp3 UTSW 8 71490517 unclassified probably null
Z1177:Gtpbp3 UTSW 8 71489069 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGCACCATCTTCGCACTCAG -3'
(R):5'- TGGCAGAGTCATCTAGAAGGC -3'

Sequencing Primer
(F):5'- TTCGCACTCAGCTCCGG -3'
(R):5'- GGCCTGGGTTAATATGATACATCTC -3'
Posted On2019-10-17