Incidental Mutation 'R7532:Esp34'
ID583392
Institutional Source Beutler Lab
Gene Symbol Esp34
Ensembl Gene ENSMUSG00000092244
Gene Nameexocrine gland secreted peptide 34
SynonymsGm20410
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7532 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location38554192-38560621 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 38559620 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 135 (V135G)
Ref Sequence ENSEMBL: ENSMUSP00000133675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173055] [ENSMUST00000178654]
Predicted Effect possibly damaging
Transcript: ENSMUST00000173055
AA Change: V135G

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133675
Gene: ENSMUSG00000092244
AA Change: V135G

DomainStartEndE-ValueType
transmembrane domain 66 88 N/A INTRINSIC
Pfam:ESP 92 147 9.1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000178654
AA Change: V67G

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136619
Gene: ENSMUSG00000092244
AA Change: V67G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
low complexity region 77 83 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 T A 19: 53,232,158 I174K probably damaging Het
Ano2 A T 6: 125,963,704 I597F probably damaging Het
Ap1g1 T C 8: 109,860,164 V813A probably damaging Het
Bpnt1 A T 1: 185,352,326 I207F possibly damaging Het
Brinp3 T A 1: 146,901,401 W529R probably damaging Het
C2cd2l C T 9: 44,315,384 R355Q probably benign Het
Ccser1 T A 6: 62,379,931 C784* probably null Het
Cdh7 A T 1: 110,138,159 D721V probably damaging Het
Chd9 A G 8: 90,994,565 I994V unknown Het
Cst13 T G 2: 148,823,207 Y41D probably benign Het
Cyth2 C T 7: 45,808,024 A342T probably benign Het
Dapk1 T C 13: 60,730,886 L563P probably damaging Het
Dclk3 T G 9: 111,467,528 S47A probably benign Het
Dync1h1 C A 12: 110,651,577 N3183K probably benign Het
Enpp1 C T 10: 24,675,987 V165M probably benign Het
Ephx3 T C 17: 32,188,789 N173S possibly damaging Het
Erc1 T A 6: 119,779,631 D388V probably benign Het
Gfy G A 7: 45,178,037 P212S probably damaging Het
Gm5239 C T 18: 35,536,742 R54C probably benign Het
Gtpbp3 T C 8: 71,489,463 F113L probably benign Het
Hectd1 T A 12: 51,790,450 D775V probably damaging Het
Ifrd2 T G 9: 107,592,522 S431R probably damaging Het
Impg2 G A 16: 56,267,180 A1121T probably damaging Het
Irx1 A G 13: 71,960,195 F123L possibly damaging Het
Itgb6 C T 2: 60,669,213 V79I probably benign Het
Kcnd3 G A 3: 105,668,210 R550H probably damaging Het
Klhl9 A T 4: 88,720,853 S384T possibly damaging Het
Kng2 T C 16: 23,027,044 probably null Het
Lipo3 T C 19: 33,583,064 N67S possibly damaging Het
Mgst1 T C 6: 138,153,506 S78P probably benign Het
Ms4a14 A G 19: 11,303,959 Y412H possibly damaging Het
Mucl2 A C 15: 103,896,052 I124S unknown Het
Myh3 A G 11: 67,091,095 M806V probably benign Het
Nelfcd T C 2: 174,426,396 L501P probably damaging Het
Nlrp6 C A 7: 140,925,184 P748Q probably benign Het
Olfr341 C T 2: 36,480,126 M1I probably null Het
Olfr430 T C 1: 174,070,098 S267P probably benign Het
Plxna2 G A 1: 194,644,819 A354T probably benign Het
Prpf39 G T 12: 65,053,371 V273L probably benign Het
Rad9a T C 19: 4,201,523 probably benign Het
Rnf135 A G 11: 80,198,906 D356G probably benign Het
Rragd G T 4: 33,004,166 A153S possibly damaging Het
Selenot G T 3: 58,585,232 V47L probably benign Het
Smc2 T C 4: 52,451,013 L277P probably damaging Het
Sp7 A G 15: 102,359,149 F92S possibly damaging Het
Spata1 A T 3: 146,468,191 I380N possibly damaging Het
Spdye4b G T 5: 143,194,897 R39S possibly damaging Het
Stom C A 2: 35,321,577 R144L possibly damaging Het
Tex37 T C 6: 70,913,637 K57R probably benign Het
Tsc22d1 T C 14: 76,416,046 probably benign Het
Unc13b A G 4: 43,249,565 T998A probably benign Het
Vcl C A 14: 21,029,324 A965D probably damaging Het
Vmn1r69 A T 7: 10,580,354 V150D probably damaging Het
Vmn1r90 T G 7: 14,561,264 N303T possibly damaging Het
Vmn2r69 A T 7: 85,410,414 M429K probably benign Het
Vmn2r8 T A 5: 108,802,240 Y247F probably benign Het
Washc5 A T 15: 59,367,411 S168T possibly damaging Het
Other mutations in Esp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1479:Esp34 UTSW 17 38554328 utr 5 prime probably benign
R1854:Esp34 UTSW 17 38559533 missense possibly damaging 0.85
R3908:Esp34 UTSW 17 38559641 missense possibly damaging 0.92
R4013:Esp34 UTSW 17 38559555 nonsense probably null
R4392:Esp34 UTSW 17 38559491 missense possibly damaging 0.51
R6008:Esp34 UTSW 17 38554227 utr 5 prime probably benign
R7522:Esp34 UTSW 17 38559541 missense possibly damaging 0.71
R7554:Esp34 UTSW 17 38555891 missense probably benign 0.02
R7686:Esp34 UTSW 17 38559643 missense possibly damaging 0.71
R8008:Esp34 UTSW 17 38559599 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AGTCTTGATCTCGCAGTCTCTG -3'
(R):5'- ACAGTATTTAGAACACTAGGAGCC -3'

Sequencing Primer
(F):5'- GATCTCGCAGTCTCTGTTCATCCTG -3'
(R):5'- ACACTAGGAGCCAATATTTTATTTGG -3'
Posted On2019-10-17