Incidental Mutation 'R7532:Ms4a14'
ID583395
Institutional Source Beutler Lab
Gene Symbol Ms4a14
Ensembl Gene ENSMUSG00000099398
Gene Namemembrane-spanning 4-domains, subfamily A, member 14
SynonymsLOC383435
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R7532 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location11301249-11314454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11303959 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 412 (Y412H)
Ref Sequence ENSEMBL: ENSMUSP00000140996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187467]
Predicted Effect possibly damaging
Transcript: ENSMUST00000187467
AA Change: Y412H

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140996
Gene: ENSMUSG00000099398
AA Change: Y412H

DomainStartEndE-ValueType
Pfam:CD20 44 182 2.9e-27 PFAM
internal_repeat_2 356 466 2.78e-10 PROSPERO
internal_repeat_1 390 506 1.75e-17 PROSPERO
low complexity region 522 540 N/A INTRINSIC
low complexity region 625 640 N/A INTRINSIC
low complexity region 642 660 N/A INTRINSIC
internal_repeat_1 665 786 1.75e-17 PROSPERO
internal_repeat_2 700 811 2.78e-10 PROSPERO
low complexity region 911 936 N/A INTRINSIC
low complexity region 975 992 N/A INTRINSIC
low complexity region 1079 1092 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 T A 19: 53,232,158 I174K probably damaging Het
Ano2 A T 6: 125,963,704 I597F probably damaging Het
Ap1g1 T C 8: 109,860,164 V813A probably damaging Het
Bpnt1 A T 1: 185,352,326 I207F possibly damaging Het
Brinp3 T A 1: 146,901,401 W529R probably damaging Het
C2cd2l C T 9: 44,315,384 R355Q probably benign Het
Ccser1 T A 6: 62,379,931 C784* probably null Het
Cdh7 A T 1: 110,138,159 D721V probably damaging Het
Chd9 A G 8: 90,994,565 I994V unknown Het
Cst13 T G 2: 148,823,207 Y41D probably benign Het
Cyth2 C T 7: 45,808,024 A342T probably benign Het
Dapk1 T C 13: 60,730,886 L563P probably damaging Het
Dclk3 T G 9: 111,467,528 S47A probably benign Het
Dync1h1 C A 12: 110,651,577 N3183K probably benign Het
Enpp1 C T 10: 24,675,987 V165M probably benign Het
Ephx3 T C 17: 32,188,789 N173S possibly damaging Het
Erc1 T A 6: 119,779,631 D388V probably benign Het
Esp34 T G 17: 38,559,620 V135G possibly damaging Het
Gfy G A 7: 45,178,037 P212S probably damaging Het
Gm5239 C T 18: 35,536,742 R54C probably benign Het
Gtpbp3 T C 8: 71,489,463 F113L probably benign Het
Hectd1 T A 12: 51,790,450 D775V probably damaging Het
Ifrd2 T G 9: 107,592,522 S431R probably damaging Het
Impg2 G A 16: 56,267,180 A1121T probably damaging Het
Irx1 A G 13: 71,960,195 F123L possibly damaging Het
Itgb6 C T 2: 60,669,213 V79I probably benign Het
Kcnd3 G A 3: 105,668,210 R550H probably damaging Het
Klhl9 A T 4: 88,720,853 S384T possibly damaging Het
Kng2 T C 16: 23,027,044 probably null Het
Lipo3 T C 19: 33,583,064 N67S possibly damaging Het
Mgst1 T C 6: 138,153,506 S78P probably benign Het
Mucl2 A C 15: 103,896,052 I124S unknown Het
Myh3 A G 11: 67,091,095 M806V probably benign Het
Nelfcd T C 2: 174,426,396 L501P probably damaging Het
Nlrp6 C A 7: 140,925,184 P748Q probably benign Het
Olfr341 C T 2: 36,480,126 M1I probably null Het
Olfr430 T C 1: 174,070,098 S267P probably benign Het
Plxna2 G A 1: 194,644,819 A354T probably benign Het
Prpf39 G T 12: 65,053,371 V273L probably benign Het
Rad9a T C 19: 4,201,523 probably benign Het
Rnf135 A G 11: 80,198,906 D356G probably benign Het
Rragd G T 4: 33,004,166 A153S possibly damaging Het
Selenot G T 3: 58,585,232 V47L probably benign Het
Smc2 T C 4: 52,451,013 L277P probably damaging Het
Sp7 A G 15: 102,359,149 F92S possibly damaging Het
Spata1 A T 3: 146,468,191 I380N possibly damaging Het
Spdye4b G T 5: 143,194,897 R39S possibly damaging Het
Stom C A 2: 35,321,577 R144L possibly damaging Het
Tex37 T C 6: 70,913,637 K57R probably benign Het
Tsc22d1 T C 14: 76,416,046 probably benign Het
Unc13b A G 4: 43,249,565 T998A probably benign Het
Vcl C A 14: 21,029,324 A965D probably damaging Het
Vmn1r69 A T 7: 10,580,354 V150D probably damaging Het
Vmn1r90 T G 7: 14,561,264 N303T possibly damaging Het
Vmn2r69 A T 7: 85,410,414 M429K probably benign Het
Vmn2r8 T A 5: 108,802,240 Y247F probably benign Het
Washc5 A T 15: 59,367,411 S168T possibly damaging Het
Other mutations in Ms4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Ms4a14 APN 19 11301619 missense possibly damaging 0.73
IGL03131:Ms4a14 APN 19 11307692 missense probably benign 0.01
IGL03136:Ms4a14 APN 19 11304411 missense possibly damaging 0.85
IGL03173:Ms4a14 APN 19 11304196 missense possibly damaging 0.86
IGL03210:Ms4a14 APN 19 11301961 missense possibly damaging 0.96
R0054:Ms4a14 UTSW 19 11303939 missense probably benign 0.00
R2895:Ms4a14 UTSW 19 11304231 missense possibly damaging 0.73
R4455:Ms4a14 UTSW 19 11303626 missense possibly damaging 0.53
R4574:Ms4a14 UTSW 19 11303971 missense probably benign
R4804:Ms4a14 UTSW 19 11304040 missense possibly damaging 0.73
R4815:Ms4a14 UTSW 19 11314277 missense probably benign 0.00
R4854:Ms4a14 UTSW 19 11310369 missense possibly damaging 0.51
R4858:Ms4a14 UTSW 19 11301612 missense probably benign 0.33
R5002:Ms4a14 UTSW 19 11304289 missense probably benign
R5382:Ms4a14 UTSW 19 11303057 missense possibly damaging 0.70
R5580:Ms4a14 UTSW 19 11303226 missense probably benign 0.33
R5626:Ms4a14 UTSW 19 11304055 missense probably benign
R5767:Ms4a14 UTSW 19 11302027 missense probably benign 0.18
R5801:Ms4a14 UTSW 19 11301786 missense possibly damaging 0.86
R5801:Ms4a14 UTSW 19 11301882 missense possibly damaging 0.73
R5865:Ms4a14 UTSW 19 11304217 missense possibly damaging 0.73
R5919:Ms4a14 UTSW 19 11314297 missense possibly damaging 0.86
R6261:Ms4a14 UTSW 19 11304020 missense probably benign 0.33
R6585:Ms4a14 UTSW 19 11303645 missense unknown
R6974:Ms4a14 UTSW 19 11302135 missense probably benign
R7401:Ms4a14 UTSW 19 11302230 missense possibly damaging 0.72
R7445:Ms4a14 UTSW 19 11302972 missense probably benign 0.00
R7489:Ms4a14 UTSW 19 11302031 missense probably benign 0.07
R7524:Ms4a14 UTSW 19 11303836 missense unknown
R7689:Ms4a14 UTSW 19 11302542 missense probably benign 0.33
R7732:Ms4a14 UTSW 19 11301683 missense probably benign
R7737:Ms4a14 UTSW 19 11302786 nonsense probably null
R7860:Ms4a14 UTSW 19 11302944 missense probably benign
R8098:Ms4a14 UTSW 19 11304615 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGATGGAGTCTCCTGGAATGG -3'
(R):5'- TCACCTGAATGATGCGGACC -3'

Sequencing Primer
(F):5'- ATGGAGTCTCCTGGAATGGTATTTC -3'
(R):5'- CTGAATGATGCGGACCTATCATC -3'
Posted On2019-10-17