Mutagenetix > Incidental Mutations

Incidental Mutation 'R7533:Atp8b2'

583403

Institutional Source

Beutler Lab

Gene Symbol

Atp8b2

Ensembl Gene

ENSMUSG00000060671

Gene Name

ATPase, class I, type 8B, member 2

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.217) question?

Stock #

R7533 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

89939481-89963508 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 89945524 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 144 (L144F)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069805] [ENSMUST00000107396] [ENSMUST00000166502] [ENSMUST00000168276] [ENSMUST00000170739]

Predicted Effect

probably damaging
Transcript: ENSMUST00000069805
AA Change: L829F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000063384
Gene: ENSMUSG00000060671
AA Change: L829F

Domain	Start	End	E-Value	Type
low complexity region	30	44	N/A	INTRINSIC
low complexity region	80	96	N/A	INTRINSIC
Pfam:E1-E2_ATPase	103	374	5.6e-18	PFAM
Pfam:HAD	408	842	1.3e-17	PFAM
Pfam:Hydrolase_like2	491	590	1e-11	PFAM
Pfam:Hydrolase	590	845	7.9e-8	PFAM
low complexity region	1133	1147	N/A	INTRINSIC
low complexity region	1167	1190	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107396
AA Change: L834F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103019
Gene: ENSMUSG00000060671
AA Change: L834F

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	15	81	1.3e-29	PFAM
Pfam:E1-E2_ATPase	81	351	2.7e-9	PFAM
Pfam:HAD	389	847	1.5e-17	PFAM
Pfam:Cation_ATPase	472	571	4.3e-12	PFAM
Pfam:PhoLip_ATPase_C	864	1118	2e-84	PFAM
low complexity region	1138	1152	N/A	INTRINSIC
low complexity region	1172	1195	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166502

SMART Domains

Protein: ENSMUSP00000132201
Gene: ENSMUSG00000060671

Domain	Start	End	E-Value	Type
SCOP:d1eula_	2	95	5e-7	SMART
low complexity region	100	109	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000168276
AA Change: L810F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128423
Gene: ENSMUSG00000060671
AA Change: L810F

Domain	Start	End	E-Value	Type
low complexity region	8	25	N/A	INTRINSIC
low complexity region	61	77	N/A	INTRINSIC
Pfam:E1-E2_ATPase	84	355	2.5e-18	PFAM
Pfam:HAD	389	823	7.9e-18	PFAM
Pfam:Hydrolase_like2	472	571	3.6e-12	PFAM
Pfam:Hydrolase	571	826	6.5e-8	PFAM
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1148	1171	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170739

SMART Domains

Protein: ENSMUSP00000127720
Gene: ENSMUSG00000060671

Domain	Start	End	E-Value	Type
Pfam:Hydrolase_like2	1	82	1.4e-7	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000130545
Gene: ENSMUSG00000060671
AA Change: L144F

Domain	Start	End	E-Value	Type
Pfam:HAD	2	158	3.3e-8	PFAM
Pfam:Hydrolase_3	124	167	1.7e-6	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agr2	T	C	12: 35,996,129		probably null	Het
AI314180	T	C	4: 58,809,411	I1654M	probably benign	Het
Alpk2	A	T	18: 65,304,603	S1240T	probably damaging	Het
Cck	T	C	9: 121,490,135	D94G	probably damaging	Het
Ccser1	A	T	6: 61,638,490	T659S	probably benign	Het
Cfap74	C	A	4: 155,415,743	D15E		Het
Commd5	G	A	15: 76,900,576	A58T	probably benign	Het
Dctn2	A	G	10: 127,267,478	D34G	possibly damaging	Het
Epha6	T	C	16: 60,205,562	T506A	probably damaging	Het
Fat4	A	C	3: 39,007,257	I4330L	probably benign	Het
Fcho2	G	T	13: 98,784,799	Q193K	probably benign	Het
Hace1	A	T	10: 45,711,474	I890L	probably benign	Het
Igsf11	T	G	16: 39,008,874	N102K	probably benign	Het
Il7r	G	A	15: 9,507,961	S425L	probably benign	Het
Itga3	G	T	11: 95,046,518	Q1011K	probably benign	Het
Kif3c	T	A	12: 3,366,510	I177N	probably damaging	Het
Neb	G	A	2: 52,224,566	A1048V		Het
Neu4	C	T	1: 94,022,400	T27M	probably benign	Het
Olfr549	T	C	7: 102,554,511	S76P	probably damaging	Het
P4htm	T	C	9: 108,596,937	H134R	probably benign	Het
Padi6	T	C	4: 140,731,195	D462G	probably damaging	Het
Pi4ka	T	C	16: 17,297,661	D1375G		Het
Ptgr1	C	T	4: 58,971,011	R247H	possibly damaging	Het
Rad50	T	C	11: 53,698,919	N152D	probably damaging	Het
Serpina1c	T	A	12: 103,897,307	K211N	probably damaging	Het
Sgsh	T	C	11: 119,347,870	E256G	probably damaging	Het
Tnrc6b	T	C	15: 80,927,741		probably null	Het
Ube2cbp	A	G	9: 86,422,937	F284S	probably damaging	Het
Usp13	A	G	3: 32,918,942	D757G	probably damaging	Het
Vmn1r173	C	T	7: 23,702,646	A102V	probably benign	Het
Vmn2r29	G	T	7: 7,241,657	A406D	probably damaging	Het
Wdfy3	G	A	5: 101,882,488	R2385C	probably benign	Het
Zfp112	A	T	7: 24,125,327	K244M	possibly damaging	Het
Zfp61	T	C	7: 24,291,079	Q549R	probably benign	Het

Other mutations in Atp8b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02313:Atp8b2	APN	3	89949853	missense	probably damaging	1.00
IGL02472:Atp8b2	APN	3	89954239	missense	probably damaging	1.00
IGL02651:Atp8b2	APN	3	89954589	splice site	probably null
IGL03057:Atp8b2	APN	3	89944186	missense	probably damaging	1.00
IGL03349:Atp8b2	APN	3	89957817	missense	probably damaging	1.00
IGL03382:Atp8b2	APN	3	89948521	missense	probably benign	0.00
R0550:Atp8b2	UTSW	3	89959061	splice site	probably benign
R0784:Atp8b2	UTSW	3	89957073	missense	probably damaging	0.99
R1249:Atp8b2	UTSW	3	89947804	missense	possibly damaging	0.77
R1447:Atp8b2	UTSW	3	89944170	missense	probably damaging	1.00
R1568:Atp8b2	UTSW	3	89949848	missense	probably damaging	0.98
R1647:Atp8b2	UTSW	3	89941784	missense	probably benign	0.30
R1736:Atp8b2	UTSW	3	89952694	missense	probably damaging	0.98
R1907:Atp8b2	UTSW	3	89946276	missense	probably benign	0.28
R2656:Atp8b2	UTSW	3	89941758	missense	probably benign	0.05
R2888:Atp8b2	UTSW	3	89958293	missense	probably damaging	1.00
R3706:Atp8b2	UTSW	3	89945152	missense	probably damaging	0.99
R3708:Atp8b2	UTSW	3	89945152	missense	probably damaging	0.99
R3740:Atp8b2	UTSW	3	89946031	missense	probably benign
R3741:Atp8b2	UTSW	3	89946031	missense	probably benign
R3742:Atp8b2	UTSW	3	89946031	missense	probably benign
R3896:Atp8b2	UTSW	3	89957319	missense	probably damaging	1.00
R3914:Atp8b2	UTSW	3	89954448	missense	probably damaging	0.98
R4536:Atp8b2	UTSW	3	89941784	missense	probably benign	0.30
R4770:Atp8b2	UTSW	3	89957067	missense	probably damaging	0.97
R4859:Atp8b2	UTSW	3	89945980	missense	probably benign
R4905:Atp8b2	UTSW	3	89949008	missense	probably benign
R4925:Atp8b2	UTSW	3	89946623	critical splice donor site	probably null
R4955:Atp8b2	UTSW	3	89952920	unclassified	probably benign
R5433:Atp8b2	UTSW	3	89952909	unclassified	probably benign
R5458:Atp8b2	UTSW	3	89946022	missense	probably benign	0.00
R5517:Atp8b2	UTSW	3	89946031	missense	probably benign
R5663:Atp8b2	UTSW	3	89941794	missense	probably benign	0.19
R6056:Atp8b2	UTSW	3	89946221	missense	possibly damaging	0.79
R6821:Atp8b2	UTSW	3	89948173	missense	probably damaging	0.99
R7069:Atp8b2	UTSW	3	89954571	missense	probably damaging	1.00
R7178:Atp8b2	UTSW	3	89943672	missense	possibly damaging	0.88
R7552:Atp8b2	UTSW	3	89946764	missense	probably damaging	1.00
R8061:Atp8b2	UTSW	3	89946220	unclassified	probably benign
Z1088:Atp8b2	UTSW	3	89954568	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTGACCGTCTACTTCAGATC -3'
(R):5'- TGCTCTGGGAACACTGTGAC -3'

Sequencing Primer
(F):5'- GGTGACCGTCTACTTCAGATCTCATC -3'
(R):5'- GGGAACACTGTGACTCTGTTTCTC -3'

Posted On

2019-10-17