Incidental Mutation 'R7533:AI314180'
ID583404
Institutional Source Beutler Lab
Gene Symbol AI314180
Ensembl Gene ENSMUSG00000050812
Gene Nameexpressed sequence AI314180
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R7533 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location58798911-58912749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58809411 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 1654 (I1654M)
Ref Sequence ENSEMBL: ENSMUSP00000099953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102889] [ENSMUST00000149301]
Predicted Effect probably benign
Transcript: ENSMUST00000102889
AA Change: I1654M

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099953
Gene: ENSMUSG00000050812
AA Change: I1654M

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 1.1e-155 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1491 3e-31 SMART
low complexity region 1781 1797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149301
SMART Domains Protein: ENSMUSP00000117585
Gene: ENSMUSG00000050812

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 4e-163 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1490 8e-32 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agr2 T C 12: 35,996,129 probably null Het
Alpk2 A T 18: 65,304,603 S1240T probably damaging Het
Atp8b2 G A 3: 89,945,524 L144F Het
Cck T C 9: 121,490,135 D94G probably damaging Het
Ccser1 A T 6: 61,638,490 T659S probably benign Het
Cfap74 C A 4: 155,415,743 D15E Het
Commd5 G A 15: 76,900,576 A58T probably benign Het
Dctn2 A G 10: 127,267,478 D34G possibly damaging Het
Epha6 T C 16: 60,205,562 T506A probably damaging Het
Fat4 A C 3: 39,007,257 I4330L probably benign Het
Fcho2 G T 13: 98,784,799 Q193K probably benign Het
Hace1 A T 10: 45,711,474 I890L probably benign Het
Igsf11 T G 16: 39,008,874 N102K probably benign Het
Il7r G A 15: 9,507,961 S425L probably benign Het
Itga3 G T 11: 95,046,518 Q1011K probably benign Het
Kif3c T A 12: 3,366,510 I177N probably damaging Het
Neb G A 2: 52,224,566 A1048V Het
Neu4 C T 1: 94,022,400 T27M probably benign Het
Olfr549 T C 7: 102,554,511 S76P probably damaging Het
P4htm T C 9: 108,596,937 H134R probably benign Het
Padi6 T C 4: 140,731,195 D462G probably damaging Het
Pi4ka T C 16: 17,297,661 D1375G Het
Ptgr1 C T 4: 58,971,011 R247H possibly damaging Het
Rad50 T C 11: 53,698,919 N152D probably damaging Het
Serpina1c T A 12: 103,897,307 K211N probably damaging Het
Sgsh T C 11: 119,347,870 E256G probably damaging Het
Tnrc6b T C 15: 80,927,741 probably null Het
Ube2cbp A G 9: 86,422,937 F284S probably damaging Het
Usp13 A G 3: 32,918,942 D757G probably damaging Het
Vmn1r173 C T 7: 23,702,646 A102V probably benign Het
Vmn2r29 G T 7: 7,241,657 A406D probably damaging Het
Wdfy3 G A 5: 101,882,488 R2385C probably benign Het
Zfp112 A T 7: 24,125,327 K244M possibly damaging Het
Zfp61 T C 7: 24,291,079 Q549R probably benign Het
Other mutations in AI314180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:AI314180 APN 4 58828047 missense possibly damaging 0.95
IGL01145:AI314180 APN 4 58811501 missense probably null 0.08
IGL01371:AI314180 APN 4 58809718 missense probably damaging 1.00
IGL01445:AI314180 APN 4 58833988 missense probably benign 0.08
IGL01452:AI314180 APN 4 58836181 missense probably damaging 0.99
IGL01626:AI314180 APN 4 58832814 splice site probably benign
IGL01672:AI314180 APN 4 58814041 missense probably benign 0.40
IGL01943:AI314180 APN 4 58849937 missense possibly damaging 0.91
IGL01944:AI314180 APN 4 58861544 missense probably benign 0.42
IGL02190:AI314180 APN 4 58800190 missense probably benign 0.12
IGL02272:AI314180 APN 4 58811731 missense probably benign 0.00
IGL02435:AI314180 APN 4 58830325 splice site probably benign
IGL02516:AI314180 APN 4 58877102 missense probably damaging 1.00
IGL02540:AI314180 APN 4 58805534 splice site probably benign
IGL02709:AI314180 APN 4 58872699 missense possibly damaging 0.90
IGL02742:AI314180 APN 4 58840757 missense probably damaging 0.96
IGL02812:AI314180 APN 4 58864343 splice site probably benign
IGL02828:AI314180 APN 4 58875512 missense possibly damaging 0.59
IGL03130:AI314180 APN 4 58800288 missense probably benign
IGL03179:AI314180 APN 4 58832777 missense probably damaging 1.00
IGL03237:AI314180 APN 4 58810668 missense probably benign 0.40
IGL03344:AI314180 APN 4 58828538 missense probably damaging 1.00
BB006:AI314180 UTSW 4 58869554 missense probably damaging 1.00
BB016:AI314180 UTSW 4 58869554 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0313:AI314180 UTSW 4 58811892 missense probably benign 0.11
R0399:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R0487:AI314180 UTSW 4 58819155 missense probably damaging 1.00
R0492:AI314180 UTSW 4 58864418 missense probably damaging 1.00
R0705:AI314180 UTSW 4 58885366 critical splice donor site probably null
R0847:AI314180 UTSW 4 58841439 missense probably benign 0.14
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1482:AI314180 UTSW 4 58820163 missense possibly damaging 0.85
R1529:AI314180 UTSW 4 58832701 splice site probably null
R1771:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1776:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1822:AI314180 UTSW 4 58805539 critical splice donor site probably null
R1864:AI314180 UTSW 4 58849942 missense possibly damaging 0.62
R2029:AI314180 UTSW 4 58844165 nonsense probably null
R2061:AI314180 UTSW 4 58824270 missense probably damaging 1.00
R2125:AI314180 UTSW 4 58833978 missense probably benign
R2266:AI314180 UTSW 4 58830332 critical splice donor site probably null
R2889:AI314180 UTSW 4 58836165 missense probably benign
R2902:AI314180 UTSW 4 58809691 missense probably benign 0.31
R2903:AI314180 UTSW 4 58828622 missense possibly damaging 0.50
R2925:AI314180 UTSW 4 58833928 nonsense probably null
R4151:AI314180 UTSW 4 58836254 missense possibly damaging 0.51
R4225:AI314180 UTSW 4 58847027 missense probably damaging 1.00
R4486:AI314180 UTSW 4 58820086 intron probably benign
R4576:AI314180 UTSW 4 58834708 intron probably benign
R4580:AI314180 UTSW 4 58840751 missense probably damaging 1.00
R4654:AI314180 UTSW 4 58834523 missense possibly damaging 0.86
R4688:AI314180 UTSW 4 58840757 missense probably damaging 0.96
R4726:AI314180 UTSW 4 58844191 missense probably damaging 1.00
R4825:AI314180 UTSW 4 58850911 missense probably damaging 0.99
R4928:AI314180 UTSW 4 58827073 missense probably damaging 1.00
R5098:AI314180 UTSW 4 58877048 missense probably damaging 1.00
R5284:AI314180 UTSW 4 58836172 missense possibly damaging 0.90
R5375:AI314180 UTSW 4 58809401 nonsense probably null
R5382:AI314180 UTSW 4 58850934 missense probably benign 0.38
R5487:AI314180 UTSW 4 58809421 missense probably benign 0.22
R5703:AI314180 UTSW 4 58877171 splice site probably null
R5761:AI314180 UTSW 4 58853131 missense probably damaging 1.00
R5791:AI314180 UTSW 4 58814027 missense possibly damaging 0.90
R5791:AI314180 UTSW 4 58822111 missense probably damaging 1.00
R5928:AI314180 UTSW 4 58849948 missense possibly damaging 0.59
R6062:AI314180 UTSW 4 58826453 missense possibly damaging 0.84
R6246:AI314180 UTSW 4 58811365 splice site probably null
R6298:AI314180 UTSW 4 58877157 missense probably damaging 1.00
R6326:AI314180 UTSW 4 58827068 missense probably benign 0.34
R6478:AI314180 UTSW 4 58810785 missense probably damaging 1.00
R6707:AI314180 UTSW 4 58879101 missense possibly damaging 0.52
R6846:AI314180 UTSW 4 58814081 missense possibly damaging 0.85
R6857:AI314180 UTSW 4 58814065 missense probably damaging 1.00
R6951:AI314180 UTSW 4 58853114 critical splice donor site probably null
R7088:AI314180 UTSW 4 58849766 missense possibly damaging 0.93
R7302:AI314180 UTSW 4 58834593 missense probably benign 0.43
R7337:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R7341:AI314180 UTSW 4 58809415 missense possibly damaging 0.94
R7344:AI314180 UTSW 4 58824770 missense probably benign 0.08
R7525:AI314180 UTSW 4 58847038 missense possibly damaging 0.84
R7530:AI314180 UTSW 4 58815317 missense probably damaging 0.99
R7557:AI314180 UTSW 4 58849691 missense possibly damaging 0.85
R7698:AI314180 UTSW 4 58832660 missense unknown
R7793:AI314180 UTSW 4 58853150 missense probably damaging 1.00
R7892:AI314180 UTSW 4 58828593 missense probably benign
R7894:AI314180 UTSW 4 58853708 missense probably damaging 1.00
R7929:AI314180 UTSW 4 58869554 missense probably damaging 1.00
R8010:AI314180 UTSW 4 58832681 missense unknown
R8082:AI314180 UTSW 4 58807852 missense probably benign 0.00
R8175:AI314180 UTSW 4 58872756 missense probably damaging 1.00
R8191:AI314180 UTSW 4 58872587 critical splice donor site probably null
R8326:AI314180 UTSW 4 58847093 missense probably damaging 1.00
X0060:AI314180 UTSW 4 58840752 missense possibly damaging 0.73
Z1177:AI314180 UTSW 4 58861614 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGACCCAGATAAACTATAGACC -3'
(R):5'- TTGGAAAAGTCTGTGCCCAATC -3'

Sequencing Primer
(F):5'- ATCCCTGAATACTTTATGGGGC -3'
(R):5'- GTCTGTGCCCAATCAACCC -3'
Posted On2019-10-17