Incidental Mutation 'R7533:Padi6'
ID 583406
Institutional Source Beutler Lab
Gene Symbol Padi6
Ensembl Gene ENSMUSG00000040935
Gene Name peptidyl arginine deiminase, type VI
Synonyms Padi5, Pad6, ePAD
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7533 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 140727355-140742643 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 140731195 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 462 (D462G)
Ref Sequence ENSEMBL: ENSMUSP00000044044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038749] [ENSMUST00000130267]
AlphaFold Q8K3V4
Predicted Effect probably damaging
Transcript: ENSMUST00000038749
AA Change: D462G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044044
Gene: ENSMUSG00000040935
AA Change: D462G

DomainStartEndE-ValueType
Pfam:PAD_N 1 112 5.6e-38 PFAM
Pfam:PAD_M 114 269 6e-53 PFAM
Pfam:PAD 280 679 4.7e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130267
SMART Domains Protein: ENSMUSP00000123490
Gene: ENSMUSG00000040935

DomainStartEndE-ValueType
Pfam:PAD_M 39 191 1.1e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidyl arginine deiminase family of enzymes, which catalyze the post-translational deimination of proteins by converting arginine residues into citrullines in the presence of calcium ions. The family members have distinct substrate specificities and tissue-specific expression patterns. This protein may play a role in cytoskeletal reorganization in the egg and in early embryo development. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit altered oocyte cytoplasmic structures that lead to a failure of zygotes to progress beyond the 2 cell stage and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agr2 T C 12: 35,996,129 probably null Het
AI314180 T C 4: 58,809,411 I1654M probably benign Het
Alpk2 A T 18: 65,304,603 S1240T probably damaging Het
Atp8b2 G A 3: 89,945,524 L144F Het
Cck T C 9: 121,490,135 D94G probably damaging Het
Ccser1 A T 6: 61,638,490 T659S probably benign Het
Cfap74 C A 4: 155,415,743 D15E Het
Commd5 G A 15: 76,900,576 A58T probably benign Het
Dctn2 A G 10: 127,267,478 D34G possibly damaging Het
Epha6 T C 16: 60,205,562 T506A probably damaging Het
Fat4 A C 3: 39,007,257 I4330L probably benign Het
Fcho2 G T 13: 98,784,799 Q193K probably benign Het
Hace1 A T 10: 45,711,474 I890L probably benign Het
Igsf11 T G 16: 39,008,874 N102K probably benign Het
Il7r G A 15: 9,507,961 S425L probably benign Het
Itga3 G T 11: 95,046,518 Q1011K probably benign Het
Kif3c T A 12: 3,366,510 I177N probably damaging Het
Neb G A 2: 52,224,566 A1048V Het
Neu4 C T 1: 94,022,400 T27M probably benign Het
Olfr549 T C 7: 102,554,511 S76P probably damaging Het
P4htm T C 9: 108,596,937 H134R probably benign Het
Pi4ka T C 16: 17,297,661 D1375G Het
Ptgr1 C T 4: 58,971,011 R247H possibly damaging Het
Rad50 T C 11: 53,698,919 N152D probably damaging Het
Serpina1c T A 12: 103,897,307 K211N probably damaging Het
Sgsh T C 11: 119,347,870 E256G probably damaging Het
Tnrc6b T C 15: 80,927,741 probably null Het
Ube2cbp A G 9: 86,422,937 F284S probably damaging Het
Usp13 A G 3: 32,918,942 D757G probably damaging Het
Vmn1r173 C T 7: 23,702,646 A102V probably benign Het
Vmn2r29 G T 7: 7,241,657 A406D probably damaging Het
Wdfy3 G A 5: 101,882,488 R2385C probably benign Het
Zfp112 A T 7: 24,125,327 K244M possibly damaging Het
Zfp61 T C 7: 24,291,079 Q549R probably benign Het
Other mutations in Padi6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Padi6 APN 4 140727623 missense possibly damaging 0.56
IGL01013:Padi6 APN 4 140729003 missense probably damaging 0.98
IGL01068:Padi6 APN 4 140730953 missense possibly damaging 0.70
IGL01945:Padi6 APN 4 140741924 missense probably benign 0.24
streetwise UTSW 4 140741558 nonsense probably null
R0097:Padi6 UTSW 4 140730957 missense probably benign 0.09
R0097:Padi6 UTSW 4 140730957 missense probably benign 0.09
R0135:Padi6 UTSW 4 140737352 missense probably benign 0.04
R0437:Padi6 UTSW 4 140728929 missense probably benign 0.01
R1581:Padi6 UTSW 4 140735836 missense probably damaging 1.00
R2024:Padi6 UTSW 4 140728968 missense possibly damaging 0.78
R3150:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3176:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3177:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3276:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R3277:Padi6 UTSW 4 140735389 missense probably damaging 1.00
R4168:Padi6 UTSW 4 140741934 missense probably damaging 0.99
R4727:Padi6 UTSW 4 140731195 missense probably damaging 1.00
R5063:Padi6 UTSW 4 140741880 missense probably benign 0.01
R5382:Padi6 UTSW 4 140731210 missense probably damaging 1.00
R5408:Padi6 UTSW 4 140727685 missense probably damaging 1.00
R5604:Padi6 UTSW 4 140731162 missense probably damaging 0.96
R5790:Padi6 UTSW 4 140732258 missense probably damaging 1.00
R7084:Padi6 UTSW 4 140741558 nonsense probably null
R7581:Padi6 UTSW 4 140728929 missense probably benign 0.01
R7662:Padi6 UTSW 4 140728995 missense probably benign 0.00
R7766:Padi6 UTSW 4 140730975 missense probably benign 0.02
R7872:Padi6 UTSW 4 140727762 missense probably damaging 1.00
R8333:Padi6 UTSW 4 140737376 missense probably damaging 1.00
R8347:Padi6 UTSW 4 140735408 missense probably benign 0.00
R8550:Padi6 UTSW 4 140732703 missense probably benign 0.15
R8979:Padi6 UTSW 4 140739163 missense probably benign 0.03
RF007:Padi6 UTSW 4 140729743 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGGTCACGTTCCCATAG -3'
(R):5'- GCAGTCCAATGAAGTCCACC -3'

Sequencing Primer
(F):5'- GGGTCACGTTCCCATAGCCTTC -3'
(R):5'- CCAAAGAGGTGGCTCAGTTGTC -3'
Posted On 2019-10-17