Incidental Mutation 'R7533:Vmn1r173'
ID 583411
Institutional Source Beutler Lab
Gene Symbol Vmn1r173
Ensembl Gene ENSMUSG00000115021
Gene Name vomeronasal 1 receptor 173
Synonyms Gm5892
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.582) question?
Stock # R7533 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 23700703-23711009 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 23702646 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 102 (A102V)
Ref Sequence ENSEMBL: ENSMUSP00000134645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174055] [ENSMUST00000226233] [ENSMUST00000227987]
AlphaFold E9Q8V7
Predicted Effect probably benign
Transcript: ENSMUST00000174055
AA Change: A102V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000134645
Gene: ENSMUSG00000115021
AA Change: A102V

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:V1R 43 301 5.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226233
AA Change: A102V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000227987
AA Change: A102V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agr2 T C 12: 35,996,129 probably null Het
AI314180 T C 4: 58,809,411 I1654M probably benign Het
Alpk2 A T 18: 65,304,603 S1240T probably damaging Het
Atp8b2 G A 3: 89,945,524 L144F Het
Cck T C 9: 121,490,135 D94G probably damaging Het
Ccser1 A T 6: 61,638,490 T659S probably benign Het
Cfap74 C A 4: 155,415,743 D15E Het
Commd5 G A 15: 76,900,576 A58T probably benign Het
Dctn2 A G 10: 127,267,478 D34G possibly damaging Het
Epha6 T C 16: 60,205,562 T506A probably damaging Het
Fat4 A C 3: 39,007,257 I4330L probably benign Het
Fcho2 G T 13: 98,784,799 Q193K probably benign Het
Hace1 A T 10: 45,711,474 I890L probably benign Het
Igsf11 T G 16: 39,008,874 N102K probably benign Het
Il7r G A 15: 9,507,961 S425L probably benign Het
Itga3 G T 11: 95,046,518 Q1011K probably benign Het
Kif3c T A 12: 3,366,510 I177N probably damaging Het
Neb G A 2: 52,224,566 A1048V Het
Neu4 C T 1: 94,022,400 T27M probably benign Het
Olfr549 T C 7: 102,554,511 S76P probably damaging Het
P4htm T C 9: 108,596,937 H134R probably benign Het
Padi6 T C 4: 140,731,195 D462G probably damaging Het
Pi4ka T C 16: 17,297,661 D1375G Het
Ptgr1 C T 4: 58,971,011 R247H possibly damaging Het
Rad50 T C 11: 53,698,919 N152D probably damaging Het
Serpina1c T A 12: 103,897,307 K211N probably damaging Het
Sgsh T C 11: 119,347,870 E256G probably damaging Het
Tnrc6b T C 15: 80,927,741 probably null Het
Ube2cbp A G 9: 86,422,937 F284S probably damaging Het
Usp13 A G 3: 32,918,942 D757G probably damaging Het
Vmn2r29 G T 7: 7,241,657 A406D probably damaging Het
Wdfy3 G A 5: 101,882,488 R2385C probably benign Het
Zfp112 A T 7: 24,125,327 K244M possibly damaging Het
Zfp61 T C 7: 24,291,079 Q549R probably benign Het
Other mutations in Vmn1r173
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:Vmn1r173 APN 7 23702707 missense probably benign 0.01
IGL01637:Vmn1r173 APN 7 23702948 missense probably damaging 0.96
IGL01878:Vmn1r173 APN 7 23702452 missense probably damaging 1.00
IGL02036:Vmn1r173 APN 7 23702896 missense probably benign 0.04
IGL02039:Vmn1r173 APN 7 23702896 missense probably benign 0.04
IGL02171:Vmn1r173 APN 7 23702896 missense probably benign 0.04
IGL02209:Vmn1r173 APN 7 23703161 missense probably benign 0.25
PIT4515001:Vmn1r173 UTSW 7 23702486 nonsense probably null
R0157:Vmn1r173 UTSW 7 23702397 missense probably damaging 0.99
R0226:Vmn1r173 UTSW 7 23703083 missense possibly damaging 0.65
R0482:Vmn1r173 UTSW 7 23702791 missense probably damaging 0.99
R0792:Vmn1r173 UTSW 7 23702735 missense probably benign 0.01
R1242:Vmn1r173 UTSW 7 23703225 missense probably damaging 1.00
R1390:Vmn1r173 UTSW 7 23702898 missense possibly damaging 0.82
R1641:Vmn1r173 UTSW 7 23703108 missense probably benign 0.06
R1867:Vmn1r173 UTSW 7 23703235 missense unknown
R2325:Vmn1r173 UTSW 7 23703112 nonsense probably null
R3863:Vmn1r173 UTSW 7 23702552 missense probably damaging 1.00
R4407:Vmn1r173 UTSW 7 23703016 missense probably damaging 1.00
R4717:Vmn1r173 UTSW 7 23703212 missense probably damaging 1.00
R4841:Vmn1r173 UTSW 7 23702936 missense probably damaging 1.00
R4842:Vmn1r173 UTSW 7 23702936 missense probably damaging 1.00
R5966:Vmn1r173 UTSW 7 23702687 missense probably benign 0.00
R6022:Vmn1r173 UTSW 7 23702835 missense probably benign 0.07
R6114:Vmn1r173 UTSW 7 23702829 missense possibly damaging 0.53
R6657:Vmn1r173 UTSW 7 23702895 missense probably damaging 0.98
R7165:Vmn1r173 UTSW 7 23702651 missense probably benign 0.00
R7195:Vmn1r173 UTSW 7 23702459 missense probably damaging 0.99
R7201:Vmn1r173 UTSW 7 23702158 start gained probably benign
R7951:Vmn1r173 UTSW 7 23703255 missense unknown
R8351:Vmn1r173 UTSW 7 23702532 nonsense probably null
R8374:Vmn1r173 UTSW 7 23702495 missense probably damaging 0.98
R8427:Vmn1r173 UTSW 7 23702534 missense probably damaging 0.99
R8451:Vmn1r173 UTSW 7 23702532 nonsense probably null
R8923:Vmn1r173 UTSW 7 23702343 start codon destroyed probably null 1.00
R9126:Vmn1r173 UTSW 7 23702583 missense probably benign 0.23
X0022:Vmn1r173 UTSW 7 23702587 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTTGCTGGCCCTCAACTGAG -3'
(R):5'- ATACCCACTTGCTGTTCAGGTC -3'

Sequencing Primer
(F):5'- CTGAGACCAAAACATGTCATTCTTGC -3'
(R):5'- CCATGGACCACTGATTTTTATAGGG -3'
Posted On 2019-10-17