Mutagenetix > Incidental Mutations

Incidental Mutation 'R7533:Olfr549'

583414

Institutional Source

Beutler Lab

Gene Symbol

Olfr549

Ensembl Gene

ENSMUSG00000073977

Gene Name

olfactory receptor 549

Synonyms

MOR31-3, GA_x6K02T2PBJ9-5274337-5275287

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R7533 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

102549870-102555842 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 102554511 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 76 (S76P)

Ref Sequence

ENSEMBL: ENSMUSP00000150373 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033264] [ENSMUST00000098227] [ENSMUST00000106913] [ENSMUST00000217478]

AlphaFold

E9Q542

Predicted Effect

probably benign
Transcript: ENSMUST00000033264

SMART Domains

Protein: ENSMUSP00000033264
Gene: ENSMUSG00000030966

Domain	Start	End	E-Value	Type
RING	12	50	6e-8	SMART
BBOX	83	124	2.71e-15	SMART
coiled coil region	184	242	N/A	INTRINSIC
PRY	282	334	1.08e-23	SMART
SPRY	335	461	8.9e-35	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000098227
AA Change: S76P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000095829
Gene: ENSMUSG00000073977
AA Change: S76P

Domain	Start	End	E-Value	Type
Pfam:7tm_4	33	312	1.7e-105	PFAM
Pfam:7TM_GPCR_Srsx	37	225	1.2e-11	PFAM
Pfam:7tm_1	43	294	1e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106913

SMART Domains

Protein: ENSMUSP00000102526
Gene: ENSMUSG00000030966

Domain	Start	End	E-Value	Type
RING	12	50	6e-8	SMART
BBOX	83	124	2.71e-15	SMART
coiled coil region	184	242	N/A	INTRINSIC
PRY	282	334	1.08e-23	SMART
SPRY	335	461	8.9e-35	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000217478
AA Change: S76P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.6329

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agr2	T	C	12: 35,996,129		probably null	Het
AI314180	T	C	4: 58,809,411	I1654M	probably benign	Het
Alpk2	A	T	18: 65,304,603	S1240T	probably damaging	Het
Atp8b2	G	A	3: 89,945,524	L144F		Het
Cck	T	C	9: 121,490,135	D94G	probably damaging	Het
Ccser1	A	T	6: 61,638,490	T659S	probably benign	Het
Cfap74	C	A	4: 155,415,743	D15E		Het
Commd5	G	A	15: 76,900,576	A58T	probably benign	Het
Dctn2	A	G	10: 127,267,478	D34G	possibly damaging	Het
Epha6	T	C	16: 60,205,562	T506A	probably damaging	Het
Fat4	A	C	3: 39,007,257	I4330L	probably benign	Het
Fcho2	G	T	13: 98,784,799	Q193K	probably benign	Het
Hace1	A	T	10: 45,711,474	I890L	probably benign	Het
Igsf11	T	G	16: 39,008,874	N102K	probably benign	Het
Il7r	G	A	15: 9,507,961	S425L	probably benign	Het
Itga3	G	T	11: 95,046,518	Q1011K	probably benign	Het
Kif3c	T	A	12: 3,366,510	I177N	probably damaging	Het
Neb	G	A	2: 52,224,566	A1048V		Het
Neu4	C	T	1: 94,022,400	T27M	probably benign	Het
P4htm	T	C	9: 108,596,937	H134R	probably benign	Het
Padi6	T	C	4: 140,731,195	D462G	probably damaging	Het
Pi4ka	T	C	16: 17,297,661	D1375G		Het
Ptgr1	C	T	4: 58,971,011	R247H	possibly damaging	Het
Rad50	T	C	11: 53,698,919	N152D	probably damaging	Het
Serpina1c	T	A	12: 103,897,307	K211N	probably damaging	Het
Sgsh	T	C	11: 119,347,870	E256G	probably damaging	Het
Tnrc6b	T	C	15: 80,927,741		probably null	Het
Ube2cbp	A	G	9: 86,422,937	F284S	probably damaging	Het
Usp13	A	G	3: 32,918,942	D757G	probably damaging	Het
Vmn1r173	C	T	7: 23,702,646	A102V	probably benign	Het
Vmn2r29	G	T	7: 7,241,657	A406D	probably damaging	Het
Wdfy3	G	A	5: 101,882,488	R2385C	probably benign	Het
Zfp112	A	T	7: 24,125,327	K244M	possibly damaging	Het
Zfp61	T	C	7: 24,291,079	Q549R	probably benign	Het

Other mutations in Olfr549

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Olfr549	APN	7	102554891	missense	probably damaging	1.00
IGL02048:Olfr549	APN	7	102554883	missense	probably damaging	1.00
IGL02314:Olfr549	APN	7	102555111	missense	probably damaging	1.00
IGL03154:Olfr549	APN	7	102554706	missense	probably benign
R0783:Olfr549	UTSW	7	102554439	missense	probably benign	0.01
R2009:Olfr549	UTSW	7	102554944	missense	probably damaging	1.00
R2145:Olfr549	UTSW	7	102555060	splice site	probably null
R3547:Olfr549	UTSW	7	102554470	missense	probably damaging	1.00
R6843:Olfr549	UTSW	7	102554721	missense	probably benign
R7294:Olfr549	UTSW	7	102554953	missense	probably damaging	1.00
R9354:Olfr549	UTSW	7	102555190	missense	possibly damaging	0.82
X0018:Olfr549	UTSW	7	102554728	missense	probably benign	0.00
Z1177:Olfr549	UTSW	7	102554971	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGGAACCAGCCATTCTGTC -3'
(R):5'- ACATGACTGAGCACTGTGC -3'

Sequencing Primer
(F):5'- CATTCTGTTGGGCATCCCTGG -3'
(R):5'- CTGTAGTGTAGTGGGTCACAG -3'

Posted On

2019-10-17