Incidental Mutation 'R7533:Olfr549'
ID583414
Institutional Source Beutler Lab
Gene Symbol Olfr549
Ensembl Gene ENSMUSG00000073977
Gene Nameolfactory receptor 549
SynonymsMOR31-3, GA_x6K02T2PBJ9-5274337-5275287
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R7533 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102549870-102555842 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102554511 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 76 (S76P)
Ref Sequence ENSEMBL: ENSMUSP00000150373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033264] [ENSMUST00000098227] [ENSMUST00000106913] [ENSMUST00000217478]
Predicted Effect probably benign
Transcript: ENSMUST00000033264
SMART Domains Protein: ENSMUSP00000033264
Gene: ENSMUSG00000030966

DomainStartEndE-ValueType
RING 12 50 6e-8 SMART
BBOX 83 124 2.71e-15 SMART
coiled coil region 184 242 N/A INTRINSIC
PRY 282 334 1.08e-23 SMART
SPRY 335 461 8.9e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098227
AA Change: S76P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095829
Gene: ENSMUSG00000073977
AA Change: S76P

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 1.7e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 225 1.2e-11 PFAM
Pfam:7tm_1 43 294 1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106913
SMART Domains Protein: ENSMUSP00000102526
Gene: ENSMUSG00000030966

DomainStartEndE-ValueType
RING 12 50 6e-8 SMART
BBOX 83 124 2.71e-15 SMART
coiled coil region 184 242 N/A INTRINSIC
PRY 282 334 1.08e-23 SMART
SPRY 335 461 8.9e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000217478
AA Change: S76P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agr2 T C 12: 35,996,129 probably null Het
AI314180 T C 4: 58,809,411 I1654M probably benign Het
Alpk2 A T 18: 65,304,603 S1240T probably damaging Het
Atp8b2 G A 3: 89,945,524 L144F Het
Cck T C 9: 121,490,135 D94G probably damaging Het
Ccser1 A T 6: 61,638,490 T659S probably benign Het
Cfap74 C A 4: 155,415,743 D15E Het
Commd5 G A 15: 76,900,576 A58T probably benign Het
Dctn2 A G 10: 127,267,478 D34G possibly damaging Het
Epha6 T C 16: 60,205,562 T506A probably damaging Het
Fat4 A C 3: 39,007,257 I4330L probably benign Het
Fcho2 G T 13: 98,784,799 Q193K probably benign Het
Hace1 A T 10: 45,711,474 I890L probably benign Het
Igsf11 T G 16: 39,008,874 N102K probably benign Het
Il7r G A 15: 9,507,961 S425L probably benign Het
Itga3 G T 11: 95,046,518 Q1011K probably benign Het
Kif3c T A 12: 3,366,510 I177N probably damaging Het
Neb G A 2: 52,224,566 A1048V Het
Neu4 C T 1: 94,022,400 T27M probably benign Het
P4htm T C 9: 108,596,937 H134R probably benign Het
Padi6 T C 4: 140,731,195 D462G probably damaging Het
Pi4ka T C 16: 17,297,661 D1375G Het
Ptgr1 C T 4: 58,971,011 R247H possibly damaging Het
Rad50 T C 11: 53,698,919 N152D probably damaging Het
Serpina1c T A 12: 103,897,307 K211N probably damaging Het
Sgsh T C 11: 119,347,870 E256G probably damaging Het
Tnrc6b T C 15: 80,927,741 probably null Het
Ube2cbp A G 9: 86,422,937 F284S probably damaging Het
Usp13 A G 3: 32,918,942 D757G probably damaging Het
Vmn1r173 C T 7: 23,702,646 A102V probably benign Het
Vmn2r29 G T 7: 7,241,657 A406D probably damaging Het
Wdfy3 G A 5: 101,882,488 R2385C probably benign Het
Zfp112 A T 7: 24,125,327 K244M possibly damaging Het
Zfp61 T C 7: 24,291,079 Q549R probably benign Het
Other mutations in Olfr549
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Olfr549 APN 7 102554891 missense probably damaging 1.00
IGL02048:Olfr549 APN 7 102554883 missense probably damaging 1.00
IGL02314:Olfr549 APN 7 102555111 missense probably damaging 1.00
IGL03154:Olfr549 APN 7 102554706 missense probably benign
R0783:Olfr549 UTSW 7 102554439 missense probably benign 0.01
R2009:Olfr549 UTSW 7 102554944 missense probably damaging 1.00
R2145:Olfr549 UTSW 7 102555060 splice site probably null
R3547:Olfr549 UTSW 7 102554470 missense probably damaging 1.00
R6843:Olfr549 UTSW 7 102554721 missense probably benign
R7294:Olfr549 UTSW 7 102554953 missense probably damaging 1.00
X0018:Olfr549 UTSW 7 102554728 missense probably benign 0.00
Z1177:Olfr549 UTSW 7 102554971 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGGAACCAGCCATTCTGTC -3'
(R):5'- ACATGACTGAGCACTGTGC -3'

Sequencing Primer
(F):5'- CATTCTGTTGGGCATCCCTGG -3'
(R):5'- CTGTAGTGTAGTGGGTCACAG -3'
Posted On2019-10-17