Incidental Mutation 'R7533:Agr2'
ID583425
Institutional Source Beutler Lab
Gene Symbol Agr2
Ensembl Gene ENSMUSG00000020581
Gene Nameanterior gradient 2
SynonymsXAG-2, mAG-2, Gob-4, HAG-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.590) question?
Stock #R7533 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location35992907-36004087 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 35996129 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020898]
Predicted Effect probably null
Transcript: ENSMUST00000020898
SMART Domains Protein: ENSMUSP00000020898
Gene: ENSMUSG00000020581

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin_7 53 133 1.9e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, and a C-terminal ER-retention sequence. This protein plays a role in cell migration, cellular transformation and metastasis and is as a p53 inhibitor. As an ER-localized molecular chaperone, it plays a role in the folding, trafficking, and assembly of cysteine-rich transmembrane receptors and the cysteine-rich intestinal gylcoprotein mucin. This gene has been implicated in inflammatory bowel disease and cancer progression. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit colitis and increased susceptibility to induced colitis. Mice homozygous for another knock-out allele exhibit hyperplasia and defective lineage maturation in the stomach that leads to intestinal obstruction and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 T C 4: 58,809,411 I1654M probably benign Het
Alpk2 A T 18: 65,304,603 S1240T probably damaging Het
Atp8b2 G A 3: 89,945,524 L144F Het
Cck T C 9: 121,490,135 D94G probably damaging Het
Ccser1 A T 6: 61,638,490 T659S probably benign Het
Cfap74 C A 4: 155,415,743 D15E Het
Commd5 G A 15: 76,900,576 A58T probably benign Het
Dctn2 A G 10: 127,267,478 D34G possibly damaging Het
Epha6 T C 16: 60,205,562 T506A probably damaging Het
Fat4 A C 3: 39,007,257 I4330L probably benign Het
Fcho2 G T 13: 98,784,799 Q193K probably benign Het
Hace1 A T 10: 45,711,474 I890L probably benign Het
Igsf11 T G 16: 39,008,874 N102K probably benign Het
Il7r G A 15: 9,507,961 S425L probably benign Het
Itga3 G T 11: 95,046,518 Q1011K probably benign Het
Kif3c T A 12: 3,366,510 I177N probably damaging Het
Neb G A 2: 52,224,566 A1048V Het
Neu4 C T 1: 94,022,400 T27M probably benign Het
Olfr549 T C 7: 102,554,511 S76P probably damaging Het
P4htm T C 9: 108,596,937 H134R probably benign Het
Padi6 T C 4: 140,731,195 D462G probably damaging Het
Pi4ka T C 16: 17,297,661 D1375G Het
Ptgr1 C T 4: 58,971,011 R247H possibly damaging Het
Rad50 T C 11: 53,698,919 N152D probably damaging Het
Serpina1c T A 12: 103,897,307 K211N probably damaging Het
Sgsh T C 11: 119,347,870 E256G probably damaging Het
Tnrc6b T C 15: 80,927,741 probably null Het
Ube2cbp A G 9: 86,422,937 F284S probably damaging Het
Usp13 A G 3: 32,918,942 D757G probably damaging Het
Vmn1r173 C T 7: 23,702,646 A102V probably benign Het
Vmn2r29 G T 7: 7,241,657 A406D probably damaging Het
Wdfy3 G A 5: 101,882,488 R2385C probably benign Het
Zfp112 A T 7: 24,125,327 K244M possibly damaging Het
Zfp61 T C 7: 24,291,079 Q549R probably benign Het
Other mutations in Agr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Agr2 APN 12 35995581 missense possibly damaging 0.63
IGL02081:Agr2 APN 12 35995656 critical splice donor site probably null
IGL03190:Agr2 APN 12 35998635 missense probably damaging 1.00
IGL02835:Agr2 UTSW 12 35995904 missense probably benign 0.23
R5514:Agr2 UTSW 12 35996091 missense probably benign
R5894:Agr2 UTSW 12 35995510 splice site probably benign
R6196:Agr2 UTSW 12 35995592 nonsense probably null
R6584:Agr2 UTSW 12 35995626 missense probably benign
R6585:Agr2 UTSW 12 35995626 missense probably benign
R6850:Agr2 UTSW 12 35995559 missense probably benign
R7384:Agr2 UTSW 12 35995924 missense probably damaging 0.98
R7459:Agr2 UTSW 12 35997453 missense probably benign 0.20
R7567:Agr2 UTSW 12 35995947 missense probably benign 0.00
R8039:Agr2 UTSW 12 35995559 missense probably benign 0.10
R8118:Agr2 UTSW 12 35996107 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- CGATCAGCTCATCTGGACTCAG -3'
(R):5'- CACGAACACCAGGATTTCTTAC -3'

Sequencing Primer
(F):5'- GCTTTATACAGATCCAAGACAAGG -3'
(R):5'- ACACCAGGATTTCTTACACAAAATG -3'
Posted On2019-10-17