Mutagenetix > Incidental Mutations

Incidental Mutation 'R7533:Tnrc6b'

583430

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6b

Ensembl Gene

ENSMUSG00000047888

Gene Name

trinucleotide repeat containing 6b

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.194) question?

Stock #

R7533 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80711313-80941085 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 80927741 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000064336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067689]

Predicted Effect

probably null
Transcript: ENSMUST00000067689

SMART Domains

Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
coiled coil region	33	72	N/A	INTRINSIC
low complexity region	88	106	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC
low complexity region	207	220	N/A	INTRINSIC
low complexity region	242	260	N/A	INTRINSIC
low complexity region	331	346	N/A	INTRINSIC
low complexity region	363	380	N/A	INTRINSIC
low complexity region	416	425	N/A	INTRINSIC
low complexity region	475	487	N/A	INTRINSIC
internal_repeat_1	488	667	6.43e-5	PROSPERO
low complexity region	858	888	N/A	INTRINSIC
Pfam:Ago_hook	955	1095	1.2e-28	PFAM
coiled coil region	1258	1307	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1339	1623	2.8e-112	PFAM
Pfam:RRM_5	1641	1695	2e-7	PFAM
low complexity region	1705	1721	N/A	INTRINSIC
low complexity region	1748	1769	N/A	INTRINSIC
low complexity region	1792	1809	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000228124

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (36/36)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agr2	T	C	12: 35,996,129		probably null	Het
AI314180	T	C	4: 58,809,411	I1654M	probably benign	Het
Alpk2	A	T	18: 65,304,603	S1240T	probably damaging	Het
Atp8b2	G	A	3: 89,945,524	L144F		Het
Cck	T	C	9: 121,490,135	D94G	probably damaging	Het
Ccser1	A	T	6: 61,638,490	T659S	probably benign	Het
Cfap74	C	A	4: 155,415,743	D15E		Het
Commd5	G	A	15: 76,900,576	A58T	probably benign	Het
Dctn2	A	G	10: 127,267,478	D34G	possibly damaging	Het
Epha6	T	C	16: 60,205,562	T506A	probably damaging	Het
Fat4	A	C	3: 39,007,257	I4330L	probably benign	Het
Fcho2	G	T	13: 98,784,799	Q193K	probably benign	Het
Hace1	A	T	10: 45,711,474	I890L	probably benign	Het
Igsf11	T	G	16: 39,008,874	N102K	probably benign	Het
Il7r	G	A	15: 9,507,961	S425L	probably benign	Het
Itga3	G	T	11: 95,046,518	Q1011K	probably benign	Het
Kif3c	T	A	12: 3,366,510	I177N	probably damaging	Het
Neb	G	A	2: 52,224,566	A1048V		Het
Neu4	C	T	1: 94,022,400	T27M	probably benign	Het
Olfr549	T	C	7: 102,554,511	S76P	probably damaging	Het
P4htm	T	C	9: 108,596,937	H134R	probably benign	Het
Padi6	T	C	4: 140,731,195	D462G	probably damaging	Het
Pi4ka	T	C	16: 17,297,661	D1375G		Het
Ptgr1	C	T	4: 58,971,011	R247H	possibly damaging	Het
Rad50	T	C	11: 53,698,919	N152D	probably damaging	Het
Serpina1c	T	A	12: 103,897,307	K211N	probably damaging	Het
Sgsh	T	C	11: 119,347,870	E256G	probably damaging	Het
Ube2cbp	A	G	9: 86,422,937	F284S	probably damaging	Het
Usp13	A	G	3: 32,918,942	D757G	probably damaging	Het
Vmn1r173	C	T	7: 23,702,646	A102V	probably benign	Het
Vmn2r29	G	T	7: 7,241,657	A406D	probably damaging	Het
Wdfy3	G	A	5: 101,882,488	R2385C	probably benign	Het
Zfp112	A	T	7: 24,125,327	K244M	possibly damaging	Het
Zfp61	T	C	7: 24,291,079	Q549R	probably benign	Het

Other mutations in Tnrc6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01312:Tnrc6b	APN	15	80923578	missense	probably damaging	1.00
IGL01402:Tnrc6b	APN	15	80880544	missense	possibly damaging	0.71
IGL01505:Tnrc6b	APN	15	80879963	missense	probably benign	0.00
IGL01516:Tnrc6b	APN	15	80902622	missense	possibly damaging	0.93
IGL01584:Tnrc6b	APN	15	80879682	missense	probably benign	0.01
IGL01681:Tnrc6b	APN	15	80879311	unclassified	probably null
IGL01909:Tnrc6b	APN	15	80901983	missense	possibly damaging	0.88
IGL01943:Tnrc6b	APN	15	80927695	nonsense	probably null
IGL02253:Tnrc6b	APN	15	80876541	missense	probably damaging	0.99
IGL02260:Tnrc6b	APN	15	80880171	missense	probably damaging	0.99
IGL02437:Tnrc6b	APN	15	80880457	missense	probably damaging	1.00
IGL02541:Tnrc6b	APN	15	80879831	missense	probably benign	0.00
IGL02542:Tnrc6b	APN	15	80902352	missense	possibly damaging	0.83
PIT1430001:Tnrc6b	UTSW	15	80929186	missense	probably damaging	0.99
R0092:Tnrc6b	UTSW	15	80918528	missense	probably damaging	1.00
R0165:Tnrc6b	UTSW	15	80858670	splice site	probably null
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0257:Tnrc6b	UTSW	15	80894355	missense	possibly damaging	0.80
R0418:Tnrc6b	UTSW	15	80913323	missense	probably benign	0.27
R0432:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0487:Tnrc6b	UTSW	15	80880675	missense	probably benign	0.01
R0498:Tnrc6b	UTSW	15	80858719	missense	probably damaging	0.98
R0528:Tnrc6b	UTSW	15	80879403	missense	probably benign	0.00
R0533:Tnrc6b	UTSW	15	80876653	missense	probably benign	0.00
R0571:Tnrc6b	UTSW	15	80913338	missense	probably damaging	1.00
R0650:Tnrc6b	UTSW	15	80784758	missense	probably benign	0.33
R0659:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0884:Tnrc6b	UTSW	15	80902555	small deletion	probably benign
R1131:Tnrc6b	UTSW	15	80894453	missense	possibly damaging	0.45
R1188:Tnrc6b	UTSW	15	80879229	missense	probably benign
R1479:Tnrc6b	UTSW	15	80887032	unclassified	probably null
R1564:Tnrc6b	UTSW	15	80880168	missense	possibly damaging	0.95
R1645:Tnrc6b	UTSW	15	80882958	missense	probably damaging	0.99
R1924:Tnrc6b	UTSW	15	80884206	critical splice acceptor site	probably null
R1926:Tnrc6b	UTSW	15	80881162	missense	probably damaging	1.00
R1928:Tnrc6b	UTSW	15	80880723	missense	probably damaging	1.00
R1965:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R1966:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R2072:Tnrc6b	UTSW	15	80882965	missense	possibly damaging	0.89
R3084:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3552:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3736:Tnrc6b	UTSW	15	80889163	splice site	probably benign
R3791:Tnrc6b	UTSW	15	80923640	missense	probably damaging	1.00
R4170:Tnrc6b	UTSW	15	80916787	missense	probably benign	0.24
R4276:Tnrc6b	UTSW	15	80901971	missense	probably benign	0.42
R4519:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R5380:Tnrc6b	UTSW	15	80879565	missense	possibly damaging	0.56
R5470:Tnrc6b	UTSW	15	80916711	missense	possibly damaging	0.89
R5590:Tnrc6b	UTSW	15	80876502	missense	probably damaging	0.98
R5982:Tnrc6b	UTSW	15	80880816	missense	probably benign
R6269:Tnrc6b	UTSW	15	80880743	missense	probably benign	0.42
R6331:Tnrc6b	UTSW	15	80879614	missense	probably benign	0.00
R6484:Tnrc6b	UTSW	15	80879324	missense	possibly damaging	0.92
R6622:Tnrc6b	UTSW	15	80879184	missense	probably damaging	0.99
R6695:Tnrc6b	UTSW	15	80879773	missense	probably damaging	1.00
R6728:Tnrc6b	UTSW	15	80918526	missense	probably damaging	1.00
R6776:Tnrc6b	UTSW	15	80924119	missense	possibly damaging	0.87
R7159:Tnrc6b	UTSW	15	80887022	missense	possibly damaging	0.92
R7210:Tnrc6b	UTSW	15	80929285	missense	probably damaging	1.00
R7287:Tnrc6b	UTSW	15	80879541	missense	possibly damaging	0.83
R7402:Tnrc6b	UTSW	15	80884300	missense	probably damaging	1.00
R7479:Tnrc6b	UTSW	15	80889126	missense	probably benign	0.13
R7571:Tnrc6b	UTSW	15	80929393	missense	probably benign
R7594:Tnrc6b	UTSW	15	80880307	missense	possibly damaging	0.66
R7831:Tnrc6b	UTSW	15	80880379	missense	possibly damaging	0.49
R7914:Tnrc6b	UTSW	15	80880379	missense	possibly damaging	0.49
X0020:Tnrc6b	UTSW	15	80882997	missense	probably benign	0.16
X0025:Tnrc6b	UTSW	15	80881167	missense	probably benign	0.03
Z1088:Tnrc6b	UTSW	15	80927690	nonsense	probably null
Z1177:Tnrc6b	UTSW	15	80858699	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- CTACGTCTTAGCTCACATGCG -3'
(R):5'- GCAGCTATGGCCAAATGGAG -3'

Sequencing Primer
(F):5'- GCGTTTCTTACCTCTTAGATTGATG -3'
(R):5'- GTGGATCTCTACGAGTTCAAAGCC -3'

Posted On

2019-10-17