Incidental Mutation 'R7534:Vmn2r43'
ID583448
Institutional Source Beutler Lab
Gene Symbol Vmn2r43
Ensembl Gene ENSMUSG00000053720
Gene Namevomeronasal 2, receptor 43
SynonymsEC2-V2R
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R7534 (G1)
Quality Score197.009
Status Not validated
Chromosome7
Chromosomal Location8244348-8260599 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 8255231 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 328 (R328*)
Ref Sequence ENSEMBL: ENSMUSP00000069647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066317]
Predicted Effect probably null
Transcript: ENSMUST00000066317
AA Change: R328*
SMART Domains Protein: ENSMUSP00000069647
Gene: ENSMUSG00000053720
AA Change: R328*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 453 5.1e-35 PFAM
Pfam:NCD3G 496 549 7.7e-21 PFAM
Pfam:7tm_3 582 817 3e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,741,023 R993Q probably benign Het
Aif1 A C 17: 35,171,414 M120R possibly damaging Het
Ank2 T C 3: 126,934,333 probably null Het
Ankrd11 A T 8: 122,894,410 I901N probably damaging Het
Apc T C 18: 34,316,962 S2304P probably damaging Het
AW551984 A T 9: 39,591,481 C632S probably benign Het
Bicra T C 7: 15,971,935 N1527S probably damaging Het
Cacna1d A G 14: 30,079,362 L1363P probably damaging Het
Cacna1g G A 11: 94,411,078 P2037S probably benign Het
Cdc27 A G 11: 104,508,414 L724S probably damaging Het
Cttnbp2 C T 6: 18,420,765 probably null Het
Dchs1 G A 7: 105,772,373 A280V probably benign Het
Dclk3 G A 9: 111,468,218 G277R probably benign Het
Ddr1 A G 17: 35,682,622 probably null Het
Dnah7c A C 1: 46,770,067 D3515A probably damaging Het
Elovl4 G A 9: 83,790,119 T49M probably damaging Het
Fam13b A T 18: 34,498,007 F40I probably damaging Het
Fancd2os T C 6: 113,597,640 H135R probably benign Het
Fer1l6 A G 15: 58,638,026 I1446V probably damaging Het
Fyb2 T A 4: 104,999,348 Y584* probably null Het
Galnt16 A T 12: 80,597,135 L442F probably damaging Het
Garem1 T A 18: 21,299,916 probably benign Het
Ggta1 C T 2: 35,402,428 R289Q probably damaging Het
Gm11564 T C 11: 99,815,521 T28A unknown Het
Hcn1 A G 13: 117,975,425 T642A unknown Het
Hhat A T 1: 192,726,304 L173H probably damaging Het
Hook1 T G 4: 96,017,597 I585S probably benign Het
Ighg1 A T 12: 113,329,729 S114T Het
Kmt2d G A 15: 98,852,018 P2598L unknown Het
Macc1 A T 12: 119,447,519 H674L probably benign Het
Mypn T C 10: 63,193,131 E51G probably benign Het
Olfr1012 A C 2: 85,759,459 L306V probably benign Het
Olfr134 T A 17: 38,175,297 M71K probably benign Het
Olfr862 A G 9: 19,884,176 V43A probably benign Het
Pnliprp2 T A 19: 58,775,142 S408T probably benign Het
Ppara A C 15: 85,777,726 Y56S probably benign Het
Ppp1r1a A G 15: 103,532,389 C114R probably benign Het
Pycard C T 7: 127,993,485 V57I probably damaging Het
Rin3 T G 12: 102,350,941 Y143D unknown Het
Slc12a7 A G 13: 73,764,068 probably benign Het
Slitrk3 C T 3: 73,050,107 R444H probably damaging Het
Ttf2 C T 3: 100,950,412 probably null Het
Ufsp2 T A 8: 45,980,324 I25N probably benign Het
Uqcrc2 A G 7: 120,641,689 T115A possibly damaging Het
Vmn2r8 T A 5: 108,802,174 Y269F possibly damaging Het
Zbtb5 T C 4: 44,995,030 Y118C probably damaging Het
Zeb1 T C 18: 5,766,611 V374A probably damaging Het
Other mutations in Vmn2r43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01756:Vmn2r43 APN 7 8255584 missense probably benign 0.00
IGL01777:Vmn2r43 APN 7 8255273 missense probably damaging 1.00
IGL02096:Vmn2r43 APN 7 8257513 splice site probably benign
IGL02429:Vmn2r43 APN 7 8255552 missense probably benign 0.00
IGL03026:Vmn2r43 APN 7 8255097 missense probably benign 0.05
IGL03155:Vmn2r43 APN 7 8255069 missense possibly damaging 0.91
R1722:Vmn2r43 UTSW 7 8255068 missense probably damaging 0.99
R1813:Vmn2r43 UTSW 7 8255056 missense possibly damaging 0.81
R1896:Vmn2r43 UTSW 7 8255056 missense possibly damaging 0.81
R1975:Vmn2r43 UTSW 7 8255551 missense possibly damaging 0.91
R3951:Vmn2r43 UTSW 7 8255320 missense probably benign 0.00
R4658:Vmn2r43 UTSW 7 8255071 missense probably benign 0.01
R4879:Vmn2r43 UTSW 7 8255103 missense probably benign 0.01
R4896:Vmn2r43 UTSW 7 8244849 missense probably damaging 1.00
R5004:Vmn2r43 UTSW 7 8244849 missense probably damaging 1.00
R5041:Vmn2r43 UTSW 7 8244807 missense probably damaging 1.00
R5577:Vmn2r43 UTSW 7 8244812 missense probably damaging 1.00
R6073:Vmn2r43 UTSW 7 8255185 missense probably benign 0.13
R6133:Vmn2r43 UTSW 7 8244971 missense probably damaging 1.00
R6867:Vmn2r43 UTSW 7 8255126 missense probably benign 0.00
R7214:Vmn2r43 UTSW 7 8253380 critical splice donor site probably null
R7339:Vmn2r43 UTSW 7 8255307 nonsense probably null
R7424:Vmn2r43 UTSW 7 8255329 missense probably damaging 0.99
R7542:Vmn2r43 UTSW 7 8255489 missense probably benign 0.00
R7757:Vmn2r43 UTSW 7 8255254 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GCCTGATTATCAACCTGCTGC -3'
(R):5'- GATTTGATCTTCAGAATGTGGGAAC -3'

Sequencing Primer
(F):5'- TGCATGGGCTACGACATAC -3'
(R):5'- GGAACCTCCAGTTTTACGGAG -3'
Posted On2019-10-17