Incidental Mutation 'R0616:Dock4'
ID 58345
Institutional Source Beutler Lab
Gene Symbol Dock4
Ensembl Gene ENSMUSG00000035954
Gene Name dedicator of cytokinesis 4
Synonyms 6330411N01Rik, EST N28122
MMRRC Submission 038805-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.181) question?
Stock # R0616 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 40495956-40896873 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 40754414 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 468 (S468P)
Ref Sequence ENSEMBL: ENSMUSP00000047387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037488] [ENSMUST00000220912]
AlphaFold P59764
Predicted Effect probably benign
Transcript: ENSMUST00000037488
AA Change: S468P

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000047387
Gene: ENSMUSG00000035954
AA Change: S468P

DomainStartEndE-ValueType
SH3 9 66 7.29e-10 SMART
Pfam:DOCK_N 69 392 8.2e-110 PFAM
Pfam:DOCK-C2 397 583 1.9e-55 PFAM
low complexity region 829 842 N/A INTRINSIC
Pfam:DHR-2 1092 1596 5e-108 PFAM
low complexity region 1651 1664 N/A INTRINSIC
low complexity region 1681 1696 N/A INTRINSIC
low complexity region 1700 1713 N/A INTRINSIC
low complexity region 1842 1872 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1940 1950 N/A INTRINSIC
low complexity region 1958 1973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220912
AA Change: S468P

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222287
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. Heterozygotes display altered blood vessel lumen formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G T 1: 71,341,830 (GRCm39) Q1044K probably damaging Het
Abi3bp A T 16: 56,474,433 (GRCm39) T723S probably damaging Het
Ackr3 G A 1: 90,142,191 (GRCm39) V217I probably benign Het
Acnat2 A G 4: 49,380,269 (GRCm39) S370P probably damaging Het
Arap1 A G 7: 101,050,857 (GRCm39) R1152G possibly damaging Het
Arhgap15 G A 2: 44,006,729 (GRCm39) probably null Het
Arhgap5 C T 12: 52,563,848 (GRCm39) T273I possibly damaging Het
Armh4 G T 14: 50,011,113 (GRCm39) T198K possibly damaging Het
C1s2 T C 6: 124,605,723 (GRCm39) E332G probably damaging Het
Camp G A 9: 109,677,707 (GRCm39) R88W probably benign Het
Cdkl2 A G 5: 92,156,863 (GRCm39) M564T probably benign Het
Ceacam20 A G 7: 19,704,321 (GRCm39) H124R probably benign Het
Cep19 C T 16: 31,922,829 (GRCm39) R32C probably damaging Het
Cep295 G A 9: 15,243,618 (GRCm39) Q1565* probably null Het
Chd3 T C 11: 69,236,313 (GRCm39) E1932G probably damaging Het
Cibar1 G A 4: 12,168,234 (GRCm39) R210* probably null Het
Cnr2 G T 4: 135,644,873 (GRCm39) W317L probably benign Het
Cntnap5a C T 1: 116,508,279 (GRCm39) H1264Y possibly damaging Het
Depdc7 T A 2: 104,557,650 (GRCm39) N200I probably benign Het
Dscc1 C A 15: 54,946,966 (GRCm39) C253F probably benign Het
Fam217a C A 13: 35,097,666 (GRCm39) S55I probably benign Het
Farp1 G A 14: 121,514,434 (GRCm39) R921H probably damaging Het
Fat4 A G 3: 38,997,019 (GRCm39) D1746G probably damaging Het
Fbxw5 T C 2: 25,392,517 (GRCm39) F100L probably damaging Het
Gli3 C A 13: 15,836,991 (GRCm39) T458K possibly damaging Het
Gm4841 T C 18: 60,404,009 (GRCm39) Y28C probably benign Het
Gprc5d T C 6: 135,093,430 (GRCm39) E159G probably benign Het
Grm4 A T 17: 27,653,538 (GRCm39) I757N probably damaging Het
Hagh A G 17: 25,076,551 (GRCm39) Y94C probably damaging Het
Hycc1 T C 5: 24,191,770 (GRCm39) T44A probably damaging Het
Itpkb T C 1: 180,249,301 (GRCm39) I892T probably damaging Het
Kcmf1 T C 6: 72,827,467 (GRCm39) I58V probably benign Het
Khdrbs2 A G 1: 32,506,856 (GRCm39) I167V possibly damaging Het
Kmt2c A G 5: 25,504,250 (GRCm39) I275T probably benign Het
Lingo4 A G 3: 94,310,388 (GRCm39) K442R probably benign Het
Mak T C 13: 41,195,661 (GRCm39) N382D probably benign Het
Maob G A X: 16,576,402 (GRCm39) T480I possibly damaging Het
Mcoln1 A G 8: 3,565,025 (GRCm39) E573G probably benign Het
Ms4a6b G A 19: 11,504,262 (GRCm39) probably null Het
Muc5ac A G 7: 141,349,981 (GRCm39) M576V probably benign Het
Nme8 T A 13: 19,875,029 (GRCm39) D126V probably benign Het
Npy2r T A 3: 82,448,670 (GRCm39) D35V possibly damaging Het
Nrxn1 T C 17: 90,670,285 (GRCm39) D193G probably damaging Het
Or2g7 A C 17: 38,378,131 (GRCm39) E23A probably damaging Het
Or2y1e T C 11: 49,218,583 (GRCm39) L115P probably damaging Het
Or4c10b T A 2: 89,711,935 (GRCm39) V255E probably benign Het
Or4d5 A T 9: 40,012,283 (GRCm39) F168I probably damaging Het
Or52b4i T A 7: 102,191,761 (GRCm39) M206K possibly damaging Het
Or6d14 A G 6: 116,533,889 (GRCm39) I168V probably benign Het
Or8b3b A T 9: 38,584,776 (GRCm39) M1K probably null Het
Or8c17 G T 9: 38,180,630 (GRCm39) V266L probably benign Het
Or8g18 G A 9: 39,148,946 (GRCm39) T258M probably benign Het
Pabpc2 A T 18: 39,906,792 (GRCm39) H19L possibly damaging Het
Pcdhb9 A T 18: 37,535,028 (GRCm39) K341* probably null Het
Pde4dip T C 3: 97,654,849 (GRCm39) I859M probably benign Het
Pfkfb2 T C 1: 130,634,159 (GRCm39) probably null Het
Pigg C T 5: 108,461,951 (GRCm39) T94M probably damaging Het
Pik3c2b T C 1: 133,028,569 (GRCm39) F1353L probably damaging Het
Prg4 T C 1: 150,336,462 (GRCm39) D87G probably damaging Het
Prkdc A T 16: 15,508,271 (GRCm39) D974V probably damaging Het
Prmt3 A G 7: 49,437,076 (GRCm39) Y217C probably damaging Het
Proser1 A G 3: 53,382,118 (GRCm39) T192A probably damaging Het
Rab3d G A 9: 21,826,060 (GRCm39) T118M probably damaging Het
Rb1cc1 A G 1: 6,314,486 (GRCm39) K386R possibly damaging Het
Rcn2 A G 9: 55,963,534 (GRCm39) D221G probably benign Het
Rhbdl3 T G 11: 80,222,687 (GRCm39) H245Q probably damaging Het
Ribc1 T C X: 150,788,787 (GRCm39) E204G probably damaging Het
Rpap1 G A 2: 119,608,601 (GRCm39) L254F probably damaging Het
Rrp12 A G 19: 41,880,988 (GRCm39) F148L possibly damaging Het
Rusf1 A T 7: 127,871,803 (GRCm39) probably null Het
Setdb1 A T 3: 95,249,109 (GRCm39) I333K probably damaging Het
Simc1 A G 13: 54,694,845 (GRCm39) I1210V probably benign Het
Smchd1 T A 17: 71,686,569 (GRCm39) D1379V probably benign Het
Snap29 A T 16: 17,240,370 (GRCm39) K159* probably null Het
Spdye4c A T 2: 128,436,132 (GRCm39) K176M possibly damaging Het
Stk31 T A 6: 49,400,419 (GRCm39) W415R probably damaging Het
Supt6 C T 11: 78,100,321 (GRCm39) R1497Q probably damaging Het
Tenm3 A G 8: 48,729,191 (GRCm39) I1605T possibly damaging Het
Ttn T C 2: 76,676,967 (GRCm39) probably null Het
Ttn A G 2: 76,728,011 (GRCm39) probably benign Het
Ucp3 A T 7: 100,129,368 (GRCm39) T68S probably benign Het
Ugt2b36 T C 5: 87,237,336 (GRCm39) N316D probably benign Het
Usp4 T G 9: 108,244,003 (GRCm39) S247A probably benign Het
Utp20 A T 10: 88,606,613 (GRCm39) V1653D probably benign Het
Vmn1r183 A G 7: 23,754,250 (GRCm39) I18V probably benign Het
Vmn1r237 A G 17: 21,534,885 (GRCm39) M203V probably damaging Het
Vmn1r61 A T 7: 5,613,998 (GRCm39) F105L possibly damaging Het
Zfp462 T C 4: 55,011,951 (GRCm39) C158R probably damaging Het
Zfyve16 C G 13: 92,657,637 (GRCm39) R758P probably damaging Het
Other mutations in Dock4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dock4 APN 12 40,882,305 (GRCm39) missense possibly damaging 0.48
IGL00726:Dock4 APN 12 40,840,067 (GRCm39) splice site probably benign
IGL00790:Dock4 APN 12 40,884,390 (GRCm39) missense probably damaging 1.00
IGL01061:Dock4 APN 12 40,752,968 (GRCm39) missense probably benign 0.01
IGL01083:Dock4 APN 12 40,838,380 (GRCm39) splice site probably benign
IGL01412:Dock4 APN 12 40,780,040 (GRCm39) splice site probably benign
IGL01583:Dock4 APN 12 40,860,466 (GRCm39) nonsense probably null
IGL01603:Dock4 APN 12 40,743,030 (GRCm39) missense probably damaging 1.00
IGL01766:Dock4 APN 12 40,496,378 (GRCm39) nonsense probably null
IGL02067:Dock4 APN 12 40,884,384 (GRCm39) missense probably damaging 1.00
IGL02302:Dock4 APN 12 40,775,776 (GRCm39) missense probably damaging 1.00
IGL02406:Dock4 APN 12 40,827,206 (GRCm39) missense probably benign 0.01
IGL02547:Dock4 APN 12 40,787,478 (GRCm39) missense probably benign
IGL02613:Dock4 APN 12 40,860,465 (GRCm39) missense probably damaging 1.00
IGL02643:Dock4 APN 12 40,718,429 (GRCm39) missense probably damaging 1.00
IGL02952:Dock4 APN 12 40,760,902 (GRCm39) critical splice donor site probably null
IGL02994:Dock4 APN 12 40,829,159 (GRCm39) missense probably damaging 0.99
IGL03096:Dock4 APN 12 40,798,000 (GRCm39) missense probably benign 0.00
IGL03144:Dock4 APN 12 40,742,906 (GRCm39) splice site probably benign
IGL03223:Dock4 APN 12 40,867,593 (GRCm39) missense probably damaging 1.00
IGL03296:Dock4 APN 12 40,783,256 (GRCm39) missense possibly damaging 0.84
IGL03349:Dock4 APN 12 40,783,309 (GRCm39) missense probably benign 0.42
IGL03353:Dock4 APN 12 40,867,757 (GRCm39) splice site probably null
BB005:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
BB015:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0110:Dock4 UTSW 12 40,671,311 (GRCm39) splice site probably benign
R0238:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0238:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0472:Dock4 UTSW 12 40,888,437 (GRCm39) intron probably benign
R0647:Dock4 UTSW 12 40,760,883 (GRCm39) missense probably damaging 1.00
R0706:Dock4 UTSW 12 40,752,922 (GRCm39) missense probably damaging 0.98
R0791:Dock4 UTSW 12 40,754,480 (GRCm39) missense probably damaging 1.00
R0940:Dock4 UTSW 12 40,681,626 (GRCm39) splice site probably benign
R1087:Dock4 UTSW 12 40,779,937 (GRCm39) missense probably benign 0.40
R1180:Dock4 UTSW 12 40,690,413 (GRCm39) missense possibly damaging 0.52
R1194:Dock4 UTSW 12 40,879,615 (GRCm39) missense probably damaging 1.00
R1463:Dock4 UTSW 12 40,866,324 (GRCm39) frame shift probably null
R1468:Dock4 UTSW 12 40,805,809 (GRCm39) missense probably benign 0.00
R1468:Dock4 UTSW 12 40,805,809 (GRCm39) missense probably benign 0.00
R1523:Dock4 UTSW 12 40,743,024 (GRCm39) missense possibly damaging 0.88
R1616:Dock4 UTSW 12 40,719,044 (GRCm39) missense probably damaging 0.99
R1682:Dock4 UTSW 12 40,775,779 (GRCm39) missense probably damaging 1.00
R1691:Dock4 UTSW 12 40,775,754 (GRCm39) missense probably benign 0.26
R1693:Dock4 UTSW 12 40,884,721 (GRCm39) missense probably benign 0.07
R1737:Dock4 UTSW 12 40,857,000 (GRCm39) splice site probably null
R1802:Dock4 UTSW 12 40,844,597 (GRCm39) missense possibly damaging 0.90
R1813:Dock4 UTSW 12 40,686,227 (GRCm39) missense probably damaging 1.00
R1846:Dock4 UTSW 12 40,783,267 (GRCm39) missense probably benign 0.00
R1959:Dock4 UTSW 12 40,760,797 (GRCm39) missense probably damaging 1.00
R1975:Dock4 UTSW 12 40,829,641 (GRCm39) splice site probably benign
R1986:Dock4 UTSW 12 40,780,062 (GRCm39) missense probably damaging 1.00
R2105:Dock4 UTSW 12 40,742,988 (GRCm39) missense probably benign 0.00
R2134:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2135:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2154:Dock4 UTSW 12 40,894,547 (GRCm39) small insertion probably benign
R2154:Dock4 UTSW 12 40,870,661 (GRCm39) missense probably damaging 1.00
R2864:Dock4 UTSW 12 40,780,072 (GRCm39) missense probably damaging 1.00
R2890:Dock4 UTSW 12 40,673,800 (GRCm39) critical splice acceptor site probably null
R3086:Dock4 UTSW 12 40,781,862 (GRCm39) missense probably benign 0.02
R3808:Dock4 UTSW 12 40,722,809 (GRCm39) missense probably damaging 0.99
R3811:Dock4 UTSW 12 40,829,123 (GRCm39) missense possibly damaging 0.87
R3836:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R3838:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R4091:Dock4 UTSW 12 40,894,266 (GRCm39) missense probably damaging 0.99
R4735:Dock4 UTSW 12 40,681,525 (GRCm39) missense probably benign 0.31
R4752:Dock4 UTSW 12 40,496,364 (GRCm39) missense probably benign 0.04
R4828:Dock4 UTSW 12 40,718,436 (GRCm39) missense probably damaging 1.00
R5039:Dock4 UTSW 12 40,867,745 (GRCm39) missense probably damaging 1.00
R5092:Dock4 UTSW 12 40,894,440 (GRCm39) missense probably benign
R5146:Dock4 UTSW 12 40,699,491 (GRCm39) splice site probably null
R5213:Dock4 UTSW 12 40,726,741 (GRCm39) missense probably damaging 1.00
R5214:Dock4 UTSW 12 40,754,465 (GRCm39) missense probably benign 0.00
R5270:Dock4 UTSW 12 40,783,270 (GRCm39) missense probably benign 0.02
R5426:Dock4 UTSW 12 40,795,744 (GRCm39) missense probably damaging 1.00
R5474:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R5544:Dock4 UTSW 12 40,884,701 (GRCm39) missense possibly damaging 0.87
R5615:Dock4 UTSW 12 40,699,479 (GRCm39) missense probably benign 0.22
R5649:Dock4 UTSW 12 40,894,539 (GRCm39) missense probably benign 0.03
R5702:Dock4 UTSW 12 40,787,490 (GRCm39) missense probably benign 0.02
R5846:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R5847:Dock4 UTSW 12 40,671,250 (GRCm39) missense probably damaging 0.97
R5895:Dock4 UTSW 12 40,805,812 (GRCm39) missense probably damaging 1.00
R5997:Dock4 UTSW 12 40,805,833 (GRCm39) missense probably damaging 0.99
R6011:Dock4 UTSW 12 40,867,756 (GRCm39) critical splice donor site probably null
R6022:Dock4 UTSW 12 40,798,109 (GRCm39) missense probably benign 0.04
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6179:Dock4 UTSW 12 40,781,868 (GRCm39) missense probably benign 0.00
R6479:Dock4 UTSW 12 40,878,954 (GRCm39) missense probably damaging 1.00
R6516:Dock4 UTSW 12 40,781,898 (GRCm39) missense possibly damaging 0.94
R6748:Dock4 UTSW 12 40,754,465 (GRCm39) missense probably benign 0.44
R6752:Dock4 UTSW 12 40,870,616 (GRCm39) missense probably damaging 1.00
R6814:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6864:Dock4 UTSW 12 40,795,745 (GRCm39) missense probably damaging 1.00
R6872:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6891:Dock4 UTSW 12 40,829,135 (GRCm39) missense probably damaging 1.00
R6937:Dock4 UTSW 12 40,884,634 (GRCm39) missense probably benign 0.01
R6950:Dock4 UTSW 12 40,783,313 (GRCm39) missense possibly damaging 0.80
R7081:Dock4 UTSW 12 40,671,285 (GRCm39) missense probably damaging 1.00
R7129:Dock4 UTSW 12 40,878,878 (GRCm39) missense probably damaging 1.00
R7140:Dock4 UTSW 12 40,686,158 (GRCm39) missense probably benign 0.06
R7241:Dock4 UTSW 12 40,844,859 (GRCm39) missense probably damaging 1.00
R7378:Dock4 UTSW 12 40,838,243 (GRCm39) missense possibly damaging 0.94
R7714:Dock4 UTSW 12 40,775,648 (GRCm39) nonsense probably null
R7720:Dock4 UTSW 12 40,856,974 (GRCm39) missense probably damaging 0.99
R7756:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7758:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7759:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R7787:Dock4 UTSW 12 40,775,676 (GRCm39) missense probably benign
R7879:Dock4 UTSW 12 40,780,083 (GRCm39) missense possibly damaging 0.76
R7928:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R8000:Dock4 UTSW 12 40,883,118 (GRCm39) missense probably benign 0.05
R8042:Dock4 UTSW 12 40,795,759 (GRCm39) missense probably benign 0.01
R8231:Dock4 UTSW 12 40,752,950 (GRCm39) missense possibly damaging 0.88
R8234:Dock4 UTSW 12 40,884,837 (GRCm39) splice site probably null
R8758:Dock4 UTSW 12 40,838,231 (GRCm39) missense probably benign 0.12
R8871:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R8873:Dock4 UTSW 12 40,726,767 (GRCm39) nonsense probably null
R8884:Dock4 UTSW 12 40,856,884 (GRCm39) missense probably damaging 1.00
R9164:Dock4 UTSW 12 40,754,337 (GRCm39) missense probably damaging 1.00
R9225:Dock4 UTSW 12 40,879,669 (GRCm39) missense probably benign 0.02
R9276:Dock4 UTSW 12 40,699,404 (GRCm39) missense possibly damaging 0.48
R9307:Dock4 UTSW 12 40,686,155 (GRCm39) missense probably damaging 1.00
R9675:Dock4 UTSW 12 40,894,393 (GRCm39) small insertion probably benign
R9675:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,397 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,401 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,396 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9691:Dock4 UTSW 12 40,686,097 (GRCm39) missense probably damaging 1.00
RF018:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
RF025:Dock4 UTSW 12 40,894,392 (GRCm39) frame shift probably null
RF063:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
X0028:Dock4 UTSW 12 40,719,046 (GRCm39) missense probably benign 0.25
Z1176:Dock4 UTSW 12 40,681,615 (GRCm39) missense probably benign 0.16
Z1176:Dock4 UTSW 12 40,681,613 (GRCm39) missense probably benign 0.01
Z1177:Dock4 UTSW 12 40,867,640 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCCTCACTAGGTAGAGCAAAGGCAG -3'
(R):5'- GCGATGAGCCGCCAAATTACAG -3'

Sequencing Primer
(F):5'- CTAGGTAGAGCAAAGGCAGAAAAAG -3'
(R):5'- TCAAAGCTTCTCTAGGAGTCAGG -3'
Posted On 2013-07-11