Incidental Mutation 'R7534:Hcn1'
ID583467
Institutional Source Beutler Lab
Gene Symbol Hcn1
Ensembl Gene ENSMUSG00000021730
Gene Namehyperpolarization-activated, cyclic nucleotide-gated K+ 1
SynonymsHAC2, Bcng1, C630013B14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7534 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location117602320-117987418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117975425 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 642 (T642A)
Ref Sequence ENSEMBL: ENSMUSP00000006991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006991]
PDB Structure
Tetramerization dynamics of the C-terminus underlies isoform-specific cAMP-gating in HCN channels [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000006991
AA Change: T642A
SMART Domains Protein: ENSMUSP00000006991
Gene: ENSMUSG00000021730
AA Change: T642A

DomainStartEndE-ValueType
Pfam:Ion_trans_N 87 130 8.2e-24 PFAM
Pfam:Ion_trans 131 394 2.1e-23 PFAM
low complexity region 395 406 N/A INTRINSIC
Blast:cNMP 407 439 4e-13 BLAST
cNMP 464 580 1.95e-22 SMART
low complexity region 639 655 N/A INTRINSIC
low complexity region 660 680 N/A INTRINSIC
low complexity region 720 779 N/A INTRINSIC
low complexity region 878 886 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a hyperpolarization-activated cation channel that contributes to the native pacemaker currents in heart and neurons. The encoded protein can homodimerize or heterodimerize with other pore-forming subunits to form a potassium channel. This channel may act as a receptor for sour tastes. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this allele display learning deficiencies but are otherwise normal. Mice homozygous for another targeted knock-out exhibit deficit in hyperpolarization-activated currents and cold allodynia following partial nerve ligation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,741,023 R993Q probably benign Het
Aif1 A C 17: 35,171,414 M120R possibly damaging Het
Ank2 T C 3: 126,934,333 probably null Het
Ankrd11 A T 8: 122,894,410 I901N probably damaging Het
Apc T C 18: 34,316,962 S2304P probably damaging Het
AW551984 A T 9: 39,591,481 C632S probably benign Het
Bicra T C 7: 15,971,935 N1527S probably damaging Het
Cacna1d A G 14: 30,079,362 L1363P probably damaging Het
Cacna1g G A 11: 94,411,078 P2037S probably benign Het
Cdc27 A G 11: 104,508,414 L724S probably damaging Het
Cttnbp2 C T 6: 18,420,765 probably null Het
Dchs1 G A 7: 105,772,373 A280V probably benign Het
Dclk3 G A 9: 111,468,218 G277R probably benign Het
Ddr1 A G 17: 35,682,622 probably null Het
Dnah7c A C 1: 46,770,067 D3515A probably damaging Het
Elovl4 G A 9: 83,790,119 T49M probably damaging Het
Fam13b A T 18: 34,498,007 F40I probably damaging Het
Fancd2os T C 6: 113,597,640 H135R probably benign Het
Fer1l6 A G 15: 58,638,026 I1446V probably damaging Het
Fyb2 T A 4: 104,999,348 Y584* probably null Het
Galnt16 A T 12: 80,597,135 L442F probably damaging Het
Garem1 T A 18: 21,299,916 probably benign Het
Ggta1 C T 2: 35,402,428 R289Q probably damaging Het
Gm11564 T C 11: 99,815,521 T28A unknown Het
Hhat A T 1: 192,726,304 L173H probably damaging Het
Hook1 T G 4: 96,017,597 I585S probably benign Het
Ighg1 A T 12: 113,329,729 S114T Het
Kmt2d G A 15: 98,852,018 P2598L unknown Het
Macc1 A T 12: 119,447,519 H674L probably benign Het
Mypn T C 10: 63,193,131 E51G probably benign Het
Olfr1012 A C 2: 85,759,459 L306V probably benign Het
Olfr134 T A 17: 38,175,297 M71K probably benign Het
Olfr862 A G 9: 19,884,176 V43A probably benign Het
Pnliprp2 T A 19: 58,775,142 S408T probably benign Het
Ppara A C 15: 85,777,726 Y56S probably benign Het
Ppp1r1a A G 15: 103,532,389 C114R probably benign Het
Pycard C T 7: 127,993,485 V57I probably damaging Het
Rin3 T G 12: 102,350,941 Y143D unknown Het
Slc12a7 A G 13: 73,764,068 probably benign Het
Slitrk3 C T 3: 73,050,107 R444H probably damaging Het
Ttf2 C T 3: 100,950,412 probably null Het
Ufsp2 T A 8: 45,980,324 I25N probably benign Het
Uqcrc2 A G 7: 120,641,689 T115A possibly damaging Het
Vmn2r43 T A 7: 8,255,231 R328* probably null Het
Vmn2r8 T A 5: 108,802,174 Y269F possibly damaging Het
Zbtb5 T C 4: 44,995,030 Y118C probably damaging Het
Zeb1 T C 18: 5,766,611 V374A probably damaging Het
Other mutations in Hcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Hcn1 APN 13 117975993 missense probably damaging 1.00
IGL00340:Hcn1 APN 13 117602977 missense unknown
IGL01161:Hcn1 APN 13 117656922 missense unknown
IGL01723:Hcn1 APN 13 117976055 missense probably damaging 0.98
IGL02324:Hcn1 APN 13 117902886 missense unknown
IGL02491:Hcn1 APN 13 117810040 missense unknown
Thump UTSW 13 117873905 nonsense probably null
FR4976:Hcn1 UTSW 13 117975808 small insertion probably benign
PIT4504001:Hcn1 UTSW 13 117975875 missense possibly damaging 0.90
R0420:Hcn1 UTSW 13 117975375 missense unknown
R1546:Hcn1 UTSW 13 117975766 small insertion probably benign
R1558:Hcn1 UTSW 13 117975576 missense unknown
R1659:Hcn1 UTSW 13 117976074 missense probably damaging 0.99
R1667:Hcn1 UTSW 13 117603073 missense unknown
R1766:Hcn1 UTSW 13 117656734 missense probably benign 0.39
R1842:Hcn1 UTSW 13 117976008 missense probably damaging 0.99
R2051:Hcn1 UTSW 13 117976083 missense probably damaging 0.99
R3605:Hcn1 UTSW 13 117975252 missense unknown
R4259:Hcn1 UTSW 13 117975348 missense unknown
R4284:Hcn1 UTSW 13 117975733 small deletion probably benign
R4637:Hcn1 UTSW 13 117975713 missense unknown
R4679:Hcn1 UTSW 13 117657015 missense probably benign 0.39
R4777:Hcn1 UTSW 13 117975733 small deletion probably benign
R4839:Hcn1 UTSW 13 117925710 missense unknown
R4883:Hcn1 UTSW 13 117902895 critical splice donor site probably null
R5015:Hcn1 UTSW 13 117603020 missense unknown
R5060:Hcn1 UTSW 13 117873905 nonsense probably null
R5748:Hcn1 UTSW 13 117976055 missense probably damaging 0.99
R5823:Hcn1 UTSW 13 117602852 missense unknown
R6900:Hcn1 UTSW 13 117656827 missense probably benign 0.39
R7045:Hcn1 UTSW 13 117975462 missense unknown
R7049:Hcn1 UTSW 13 117975462 missense unknown
R7163:Hcn1 UTSW 13 117925547 missense unknown
R7722:Hcn1 UTSW 13 117902778 missense unknown
Predicted Primers PCR Primer
(F):5'- ACATAAGTCACCTTGGAGTAGC -3'
(R):5'- GTATAGGAGGACTGCAGACTGC -3'

Sequencing Primer
(F):5'- AGTAGCCAGGCCCATGTG -3'
(R):5'- CAGACTGCTGTGGTATAGGAGC -3'
Posted On2019-10-17