Incidental Mutation 'R0616:Gli3'
ID 58347
Institutional Source Beutler Lab
Gene Symbol Gli3
Ensembl Gene ENSMUSG00000021318
Gene Name GLI-Kruppel family member GLI3
Synonyms Bph, brachyphalangy
MMRRC Submission 038805-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0616 (G1)
Quality Score 216
Status Not validated
Chromosome 13
Chromosomal Location 15638308-15904611 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 15836991 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 458 (T458K)
Ref Sequence ENSEMBL: ENSMUSP00000106137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110510] [ENSMUST00000130065]
AlphaFold Q61602
Predicted Effect possibly damaging
Transcript: ENSMUST00000110510
AA Change: T458K

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: T458K

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 601 4.17e-3 SMART
ZnF_C2H2 607 632 1.4e-4 SMART
low complexity region 703 726 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
low complexity region 849 880 N/A INTRINSIC
low complexity region 934 944 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1166 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130065
AA Change: T458K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115989
Gene: ENSMUSG00000021318
AA Change: T458K

DomainStartEndE-ValueType
low complexity region 120 136 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 403 421 N/A INTRINSIC
ZnF_C2H2 480 505 1.53e-1 SMART
ZnF_C2H2 513 540 1.23e0 SMART
ZnF_C2H2 546 570 3.16e-3 SMART
ZnF_C2H2 576 596 1.45e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130535
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G T 1: 71,341,830 (GRCm39) Q1044K probably damaging Het
Abi3bp A T 16: 56,474,433 (GRCm39) T723S probably damaging Het
Ackr3 G A 1: 90,142,191 (GRCm39) V217I probably benign Het
Acnat2 A G 4: 49,380,269 (GRCm39) S370P probably damaging Het
Arap1 A G 7: 101,050,857 (GRCm39) R1152G possibly damaging Het
Arhgap15 G A 2: 44,006,729 (GRCm39) probably null Het
Arhgap5 C T 12: 52,563,848 (GRCm39) T273I possibly damaging Het
Armh4 G T 14: 50,011,113 (GRCm39) T198K possibly damaging Het
C1s2 T C 6: 124,605,723 (GRCm39) E332G probably damaging Het
Camp G A 9: 109,677,707 (GRCm39) R88W probably benign Het
Cdkl2 A G 5: 92,156,863 (GRCm39) M564T probably benign Het
Ceacam20 A G 7: 19,704,321 (GRCm39) H124R probably benign Het
Cep19 C T 16: 31,922,829 (GRCm39) R32C probably damaging Het
Cep295 G A 9: 15,243,618 (GRCm39) Q1565* probably null Het
Chd3 T C 11: 69,236,313 (GRCm39) E1932G probably damaging Het
Cibar1 G A 4: 12,168,234 (GRCm39) R210* probably null Het
Cnr2 G T 4: 135,644,873 (GRCm39) W317L probably benign Het
Cntnap5a C T 1: 116,508,279 (GRCm39) H1264Y possibly damaging Het
Depdc7 T A 2: 104,557,650 (GRCm39) N200I probably benign Het
Dock4 T C 12: 40,754,414 (GRCm39) S468P probably benign Het
Dscc1 C A 15: 54,946,966 (GRCm39) C253F probably benign Het
Fam217a C A 13: 35,097,666 (GRCm39) S55I probably benign Het
Farp1 G A 14: 121,514,434 (GRCm39) R921H probably damaging Het
Fat4 A G 3: 38,997,019 (GRCm39) D1746G probably damaging Het
Fbxw5 T C 2: 25,392,517 (GRCm39) F100L probably damaging Het
Gm4841 T C 18: 60,404,009 (GRCm39) Y28C probably benign Het
Gprc5d T C 6: 135,093,430 (GRCm39) E159G probably benign Het
Grm4 A T 17: 27,653,538 (GRCm39) I757N probably damaging Het
Hagh A G 17: 25,076,551 (GRCm39) Y94C probably damaging Het
Hycc1 T C 5: 24,191,770 (GRCm39) T44A probably damaging Het
Itpkb T C 1: 180,249,301 (GRCm39) I892T probably damaging Het
Kcmf1 T C 6: 72,827,467 (GRCm39) I58V probably benign Het
Khdrbs2 A G 1: 32,506,856 (GRCm39) I167V possibly damaging Het
Kmt2c A G 5: 25,504,250 (GRCm39) I275T probably benign Het
Lingo4 A G 3: 94,310,388 (GRCm39) K442R probably benign Het
Mak T C 13: 41,195,661 (GRCm39) N382D probably benign Het
Maob G A X: 16,576,402 (GRCm39) T480I possibly damaging Het
Mcoln1 A G 8: 3,565,025 (GRCm39) E573G probably benign Het
Ms4a6b G A 19: 11,504,262 (GRCm39) probably null Het
Muc5ac A G 7: 141,349,981 (GRCm39) M576V probably benign Het
Nme8 T A 13: 19,875,029 (GRCm39) D126V probably benign Het
Npy2r T A 3: 82,448,670 (GRCm39) D35V possibly damaging Het
Nrxn1 T C 17: 90,670,285 (GRCm39) D193G probably damaging Het
Or2g7 A C 17: 38,378,131 (GRCm39) E23A probably damaging Het
Or2y1e T C 11: 49,218,583 (GRCm39) L115P probably damaging Het
Or4c10b T A 2: 89,711,935 (GRCm39) V255E probably benign Het
Or4d5 A T 9: 40,012,283 (GRCm39) F168I probably damaging Het
Or52b4i T A 7: 102,191,761 (GRCm39) M206K possibly damaging Het
Or6d14 A G 6: 116,533,889 (GRCm39) I168V probably benign Het
Or8b3b A T 9: 38,584,776 (GRCm39) M1K probably null Het
Or8c17 G T 9: 38,180,630 (GRCm39) V266L probably benign Het
Or8g18 G A 9: 39,148,946 (GRCm39) T258M probably benign Het
Pabpc2 A T 18: 39,906,792 (GRCm39) H19L possibly damaging Het
Pcdhb9 A T 18: 37,535,028 (GRCm39) K341* probably null Het
Pde4dip T C 3: 97,654,849 (GRCm39) I859M probably benign Het
Pfkfb2 T C 1: 130,634,159 (GRCm39) probably null Het
Pigg C T 5: 108,461,951 (GRCm39) T94M probably damaging Het
Pik3c2b T C 1: 133,028,569 (GRCm39) F1353L probably damaging Het
Prg4 T C 1: 150,336,462 (GRCm39) D87G probably damaging Het
Prkdc A T 16: 15,508,271 (GRCm39) D974V probably damaging Het
Prmt3 A G 7: 49,437,076 (GRCm39) Y217C probably damaging Het
Proser1 A G 3: 53,382,118 (GRCm39) T192A probably damaging Het
Rab3d G A 9: 21,826,060 (GRCm39) T118M probably damaging Het
Rb1cc1 A G 1: 6,314,486 (GRCm39) K386R possibly damaging Het
Rcn2 A G 9: 55,963,534 (GRCm39) D221G probably benign Het
Rhbdl3 T G 11: 80,222,687 (GRCm39) H245Q probably damaging Het
Ribc1 T C X: 150,788,787 (GRCm39) E204G probably damaging Het
Rpap1 G A 2: 119,608,601 (GRCm39) L254F probably damaging Het
Rrp12 A G 19: 41,880,988 (GRCm39) F148L possibly damaging Het
Rusf1 A T 7: 127,871,803 (GRCm39) probably null Het
Setdb1 A T 3: 95,249,109 (GRCm39) I333K probably damaging Het
Simc1 A G 13: 54,694,845 (GRCm39) I1210V probably benign Het
Smchd1 T A 17: 71,686,569 (GRCm39) D1379V probably benign Het
Snap29 A T 16: 17,240,370 (GRCm39) K159* probably null Het
Spdye4c A T 2: 128,436,132 (GRCm39) K176M possibly damaging Het
Stk31 T A 6: 49,400,419 (GRCm39) W415R probably damaging Het
Supt6 C T 11: 78,100,321 (GRCm39) R1497Q probably damaging Het
Tenm3 A G 8: 48,729,191 (GRCm39) I1605T possibly damaging Het
Ttn T C 2: 76,676,967 (GRCm39) probably null Het
Ttn A G 2: 76,728,011 (GRCm39) probably benign Het
Ucp3 A T 7: 100,129,368 (GRCm39) T68S probably benign Het
Ugt2b36 T C 5: 87,237,336 (GRCm39) N316D probably benign Het
Usp4 T G 9: 108,244,003 (GRCm39) S247A probably benign Het
Utp20 A T 10: 88,606,613 (GRCm39) V1653D probably benign Het
Vmn1r183 A G 7: 23,754,250 (GRCm39) I18V probably benign Het
Vmn1r237 A G 17: 21,534,885 (GRCm39) M203V probably damaging Het
Vmn1r61 A T 7: 5,613,998 (GRCm39) F105L possibly damaging Het
Zfp462 T C 4: 55,011,951 (GRCm39) C158R probably damaging Het
Zfyve16 C G 13: 92,657,637 (GRCm39) R758P probably damaging Het
Other mutations in Gli3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Gli3 APN 13 15,818,884 (GRCm39) missense probably damaging 1.00
IGL00471:Gli3 APN 13 15,898,354 (GRCm39) critical splice donor site probably null
IGL00484:Gli3 APN 13 15,818,977 (GRCm39) missense possibly damaging 0.84
IGL00588:Gli3 APN 13 15,818,977 (GRCm39) missense possibly damaging 0.84
IGL01161:Gli3 APN 13 15,722,983 (GRCm39) critical splice acceptor site probably null
IGL01633:Gli3 APN 13 15,823,219 (GRCm39) missense probably damaging 1.00
IGL01799:Gli3 APN 13 15,900,746 (GRCm39) missense probably benign 0.00
IGL01861:Gli3 APN 13 15,899,910 (GRCm39) missense probably damaging 1.00
IGL02063:Gli3 APN 13 15,900,957 (GRCm39) missense possibly damaging 0.94
IGL02112:Gli3 APN 13 15,837,099 (GRCm39) missense probably damaging 1.00
IGL02255:Gli3 APN 13 15,823,304 (GRCm39) missense probably damaging 1.00
IGL02270:Gli3 APN 13 15,901,371 (GRCm39) utr 3 prime probably benign
IGL02336:Gli3 APN 13 15,894,874 (GRCm39) missense probably damaging 1.00
IGL02346:Gli3 APN 13 15,898,278 (GRCm39) missense probably damaging 1.00
IGL02744:Gli3 APN 13 15,788,471 (GRCm39) critical splice donor site probably null
IGL02877:Gli3 APN 13 15,899,327 (GRCm39) missense probably damaging 1.00
IGL02975:Gli3 APN 13 15,899,153 (GRCm39) missense probably damaging 1.00
IGL03018:Gli3 APN 13 15,834,717 (GRCm39) missense probably damaging 1.00
IGL03378:Gli3 APN 13 15,819,005 (GRCm39) missense probably damaging 1.00
IGL03406:Gli3 APN 13 15,823,166 (GRCm39) missense probably damaging 1.00
Capone UTSW 13 15,889,619 (GRCm39) missense probably damaging 1.00
Carpals UTSW 13 15,888,235 (GRCm39) critical splice donor site probably null
Ness UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
FR4737:Gli3 UTSW 13 15,818,942 (GRCm39) missense probably damaging 1.00
R0110:Gli3 UTSW 13 15,899,370 (GRCm39) missense probably damaging 1.00
R0329:Gli3 UTSW 13 15,898,143 (GRCm39) missense probably damaging 0.98
R0330:Gli3 UTSW 13 15,898,143 (GRCm39) missense probably damaging 0.98
R0360:Gli3 UTSW 13 15,899,349 (GRCm39) missense probably benign 0.32
R0364:Gli3 UTSW 13 15,899,349 (GRCm39) missense probably benign 0.32
R0469:Gli3 UTSW 13 15,899,370 (GRCm39) missense probably damaging 1.00
R0639:Gli3 UTSW 13 15,899,300 (GRCm39) missense probably damaging 1.00
R1072:Gli3 UTSW 13 15,888,190 (GRCm39) missense probably damaging 1.00
R1257:Gli3 UTSW 13 15,900,581 (GRCm39) nonsense probably null
R1270:Gli3 UTSW 13 15,898,329 (GRCm39) missense probably benign 0.02
R1424:Gli3 UTSW 13 15,900,899 (GRCm39) missense probably benign 0.00
R1481:Gli3 UTSW 13 15,788,435 (GRCm39) missense probably damaging 0.99
R1596:Gli3 UTSW 13 15,900,056 (GRCm39) missense possibly damaging 0.74
R1628:Gli3 UTSW 13 15,900,897 (GRCm39) missense probably benign 0.00
R1721:Gli3 UTSW 13 15,900,882 (GRCm39) missense probably benign 0.27
R1797:Gli3 UTSW 13 15,888,097 (GRCm39) missense probably damaging 0.99
R1813:Gli3 UTSW 13 15,823,276 (GRCm39) missense probably damaging 1.00
R1819:Gli3 UTSW 13 15,900,377 (GRCm39) nonsense probably null
R1988:Gli3 UTSW 13 15,900,965 (GRCm39) missense probably benign
R2132:Gli3 UTSW 13 15,900,134 (GRCm39) missense possibly damaging 0.74
R2352:Gli3 UTSW 13 15,836,977 (GRCm39) missense probably benign 0.02
R3085:Gli3 UTSW 13 15,835,526 (GRCm39) missense probably damaging 1.00
R3177:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R3277:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R4162:Gli3 UTSW 13 15,899,700 (GRCm39) missense possibly damaging 0.93
R4497:Gli3 UTSW 13 15,898,156 (GRCm39) missense possibly damaging 0.74
R4526:Gli3 UTSW 13 15,888,216 (GRCm39) missense probably damaging 1.00
R4979:Gli3 UTSW 13 15,899,049 (GRCm39) missense possibly damaging 0.87
R5327:Gli3 UTSW 13 15,723,092 (GRCm39) missense probably damaging 0.99
R5395:Gli3 UTSW 13 15,889,535 (GRCm39) missense probably damaging 1.00
R5494:Gli3 UTSW 13 15,900,567 (GRCm39) missense probably benign 0.28
R5609:Gli3 UTSW 13 15,723,038 (GRCm39) missense possibly damaging 0.82
R5718:Gli3 UTSW 13 15,652,750 (GRCm39) critical splice donor site probably null
R5810:Gli3 UTSW 13 15,818,894 (GRCm39) missense probably damaging 0.99
R5896:Gli3 UTSW 13 15,900,765 (GRCm39) missense probably benign 0.00
R5930:Gli3 UTSW 13 15,723,210 (GRCm39) missense probably damaging 1.00
R5964:Gli3 UTSW 13 15,900,747 (GRCm39) nonsense probably null
R5985:Gli3 UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
R6224:Gli3 UTSW 13 15,899,730 (GRCm39) missense probably benign
R6278:Gli3 UTSW 13 15,899,698 (GRCm39) missense possibly damaging 0.69
R6330:Gli3 UTSW 13 15,899,317 (GRCm39) missense probably damaging 1.00
R6383:Gli3 UTSW 13 15,898,140 (GRCm39) missense probably damaging 1.00
R6523:Gli3 UTSW 13 15,888,235 (GRCm39) critical splice donor site probably null
R7072:Gli3 UTSW 13 15,900,280 (GRCm39) missense possibly damaging 0.51
R7085:Gli3 UTSW 13 15,889,647 (GRCm39) missense probably damaging 1.00
R7228:Gli3 UTSW 13 15,899,087 (GRCm39) missense probably benign 0.00
R7327:Gli3 UTSW 13 15,900,144 (GRCm39) missense probably benign 0.02
R7451:Gli3 UTSW 13 15,900,876 (GRCm39) missense possibly damaging 0.50
R7974:Gli3 UTSW 13 15,900,841 (GRCm39) missense probably benign 0.00
R8167:Gli3 UTSW 13 15,900,228 (GRCm39) missense probably benign 0.00
R8170:Gli3 UTSW 13 15,894,793 (GRCm39) missense probably benign
R8199:Gli3 UTSW 13 15,900,576 (GRCm39) missense probably benign 0.08
R8247:Gli3 UTSW 13 15,901,360 (GRCm39) missense possibly damaging 0.82
R8332:Gli3 UTSW 13 15,888,133 (GRCm39) missense possibly damaging 0.58
R8347:Gli3 UTSW 13 15,898,110 (GRCm39) missense probably damaging 1.00
R8559:Gli3 UTSW 13 15,834,717 (GRCm39) missense probably damaging 1.00
R8676:Gli3 UTSW 13 15,889,619 (GRCm39) missense probably damaging 1.00
R8905:Gli3 UTSW 13 15,901,116 (GRCm39) missense probably benign 0.01
R9099:Gli3 UTSW 13 15,901,320 (GRCm39) missense probably damaging 1.00
R9260:Gli3 UTSW 13 15,899,675 (GRCm39) missense probably damaging 0.99
R9317:Gli3 UTSW 13 15,889,658 (GRCm39) missense probably damaging 1.00
R9475:Gli3 UTSW 13 15,900,296 (GRCm39) missense possibly damaging 0.87
R9546:Gli3 UTSW 13 15,788,443 (GRCm39) missense probably benign 0.00
R9571:Gli3 UTSW 13 15,900,858 (GRCm39) missense probably benign 0.00
R9621:Gli3 UTSW 13 15,901,253 (GRCm39) missense probably benign 0.01
R9704:Gli3 UTSW 13 15,898,058 (GRCm39) missense probably damaging 1.00
R9787:Gli3 UTSW 13 15,900,386 (GRCm39) missense probably damaging 0.96
RF010:Gli3 UTSW 13 15,900,954 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCTCACATCAGGGGAGAGAAC -3'
(R):5'- TGCAAAGGTCGCTGATTTGGGAAG -3'

Sequencing Primer
(F):5'- AAGTATGTCAGTGCCATTCGC -3'
(R):5'- ATTTGGGAAGCTGCGTCC -3'
Posted On 2013-07-11