Mutagenetix > Incidental Mutations

Incidental Mutation 'R7534:Garem1'

583477

Institutional Source

Beutler Lab

Gene Symbol

Garem1

Ensembl Gene

ENSMUSG00000042680

Gene Name

GRB2 associated regulator of MAPK1 subtype 1

Synonyms

Garem, Fam59a, LOC381126

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.163) question?

Stock #

R7534 (G1)

Quality Score

149.008

Status

Validated

Chromosome

Chromosomal Location

21127201-21300138 bp(-) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

T to A at 21299916 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000048914 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049260]

AlphaFold

Q3UFT3

Predicted Effect

probably benign
Transcript: ENSMUST00000049260

SMART Domains

Protein: ENSMUSP00000048914
Gene: ENSMUSG00000042680

Domain	Start	End	E-Value	Type
Pfam:CABIT	32	318	3.4e-79	PFAM
low complexity region	484	499	N/A	INTRINSIC
low complexity region	512	518	N/A	INTRINSIC
PDB:2DKZ\|A	795	874	2e-40	PDB
Blast:SAM	808	875	2e-36	BLAST
SCOP:d1kw4a_	812	873	4e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein which functions in the epidermal growth factor (EGF) receptor-mediated signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	G	A	1: 105,741,023	R993Q	probably benign	Het
Aif1	A	C	17: 35,171,414	M120R	possibly damaging	Het
Ank2	T	C	3: 126,934,333		probably null	Het
Ankrd11	A	T	8: 122,894,410	I901N	probably damaging	Het
Apc	T	C	18: 34,316,962	S2304P	probably damaging	Het
AW551984	A	T	9: 39,591,481	C632S	probably benign	Het
Bicra	T	C	7: 15,971,935	N1527S	probably damaging	Het
Cacna1d	A	G	14: 30,079,362	L1363P	probably damaging	Het
Cacna1g	G	A	11: 94,411,078	P2037S	probably benign	Het
Cdc27	A	G	11: 104,508,414	L724S	probably damaging	Het
Cttnbp2	C	T	6: 18,420,765		probably null	Het
Dchs1	G	A	7: 105,772,373	A280V	probably benign	Het
Dclk3	G	A	9: 111,468,218	G277R	probably benign	Het
Ddr1	A	G	17: 35,682,622		probably null	Het
Dnah7c	A	C	1: 46,770,067	D3515A	probably damaging	Het
Elovl4	G	A	9: 83,790,119	T49M	probably damaging	Het
Fam13b	A	T	18: 34,498,007	F40I	probably damaging	Het
Fancd2os	T	C	6: 113,597,640	H135R	probably benign	Het
Fer1l6	A	G	15: 58,638,026	I1446V	probably damaging	Het
Fyb2	T	A	4: 104,999,348	Y584*	probably null	Het
Galnt16	A	T	12: 80,597,135	L442F	probably damaging	Het
Ggta1	C	T	2: 35,402,428	R289Q	probably damaging	Het
Gm11564	T	C	11: 99,815,521	T28A	unknown	Het
Hcn1	A	G	13: 117,975,425	T642A	unknown	Het
Hhat	A	T	1: 192,726,304	L173H	probably damaging	Het
Hook1	T	G	4: 96,017,597	I585S	probably benign	Het
Ighg1	A	T	12: 113,329,729	S114T		Het
Kmt2d	G	A	15: 98,852,018	P2598L	unknown	Het
Macc1	A	T	12: 119,447,519	H674L	probably benign	Het
Mypn	T	C	10: 63,193,131	E51G	probably benign	Het
Olfr1012	A	C	2: 85,759,459	L306V	probably benign	Het
Olfr134	T	A	17: 38,175,297	M71K	probably benign	Het
Olfr862	A	G	9: 19,884,176	V43A	probably benign	Het
Pnliprp2	T	A	19: 58,775,142	S408T	probably benign	Het
Ppara	A	C	15: 85,777,726	Y56S	probably benign	Het
Ppp1r1a	A	G	15: 103,532,389	C114R	probably benign	Het
Pycard	C	T	7: 127,993,485	V57I	probably damaging	Het
Rin3	T	G	12: 102,350,941	Y143D	unknown	Het
Slc12a7	A	G	13: 73,764,068		probably benign	Het
Slitrk3	C	T	3: 73,050,107	R444H	probably damaging	Het
Ttf2	C	T	3: 100,950,412		probably null	Het
Ufsp2	T	A	8: 45,980,324	I25N	probably benign	Het
Uqcrc2	A	G	7: 120,641,689	T115A	possibly damaging	Het
Vmn2r43	T	A	7: 8,255,231	R328*	probably null	Het
Vmn2r8	T	A	5: 108,802,174	Y269F	possibly damaging	Het
Zbtb5	T	C	4: 44,995,030	Y118C	probably damaging	Het
Zeb1	T	C	18: 5,766,611	V374A	probably damaging	Het

Other mutations in Garem1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Garem1	APN	18	21148657	missense	probably damaging	1.00
IGL01588:Garem1	APN	18	21129797	missense	probably damaging	0.99
IGL02171:Garem1	APN	18	21129241	missense	probably damaging	0.98
IGL02270:Garem1	APN	18	21148450	missense	probably damaging	1.00
IGL03149:Garem1	APN	18	21131466	missense	probably damaging	1.00
R0136:Garem1	UTSW	18	21129991	missense	probably damaging	0.96
R0285:Garem1	UTSW	18	21129612	missense	probably benign
R0361:Garem1	UTSW	18	21299744	nonsense	probably null
R1068:Garem1	UTSW	18	21168755	missense	probably benign	0.00
R1537:Garem1	UTSW	18	21168874	splice site	probably null
R1726:Garem1	UTSW	18	21148262	missense	probably damaging	0.99
R1826:Garem1	UTSW	18	21129452	missense	probably benign	0.00
R2140:Garem1	UTSW	18	21129374	missense	probably damaging	1.00
R3714:Garem1	UTSW	18	21148890	missense	probably damaging	1.00
R3937:Garem1	UTSW	18	21148806	nonsense	probably null
R4362:Garem1	UTSW	18	21236115	missense	possibly damaging	0.62
R4441:Garem1	UTSW	18	21168750	missense	possibly damaging	0.92
R4747:Garem1	UTSW	18	21129943	missense	probably benign
R4814:Garem1	UTSW	18	21148116	missense	probably damaging	1.00
R4831:Garem1	UTSW	18	21129768	missense	probably benign	0.01
R4838:Garem1	UTSW	18	21147893	missense	probably benign	0.00
R5805:Garem1	UTSW	18	21148435	missense	probably benign	0.04
R5963:Garem1	UTSW	18	21129430	missense	probably benign	0.45
R5982:Garem1	UTSW	18	21148351	missense	possibly damaging	0.64
R6134:Garem1	UTSW	18	21129824	missense	probably benign	0.00
R6242:Garem1	UTSW	18	21129172	missense	possibly damaging	0.72
R6453:Garem1	UTSW	18	21148739	missense	probably damaging	0.99
R6485:Garem1	UTSW	18	21129837	missense	probably benign	0.00
R6596:Garem1	UTSW	18	21148739	missense	probably damaging	0.99
R6662:Garem1	UTSW	18	21148247	missense	probably benign	0.45
R6883:Garem1	UTSW	18	21129712	missense	probably benign
R6937:Garem1	UTSW	18	21147770	missense	probably benign	0.00
R7027:Garem1	UTSW	18	21129994	missense	probably benign
R7256:Garem1	UTSW	18	21148754	missense	probably damaging	1.00
R7620:Garem1	UTSW	18	21129841	missense	probably benign
R7869:Garem1	UTSW	18	21299700	missense	probably damaging	1.00
R7963:Garem1	UTSW	18	21148787	missense	probably damaging	0.98
R8058:Garem1	UTSW	18	21148564	missense	probably damaging	1.00
R8953:Garem1	UTSW	18	21131331	critical splice donor site	probably null
R9273:Garem1	UTSW	18	21148217	missense	probably damaging	0.99
R9411:Garem1	UTSW	18	21236000	critical splice donor site	probably null
R9475:Garem1	UTSW	18	21148313	missense	probably benign	0.00
Z1176:Garem1	UTSW	18	21129792	missense	probably damaging	1.00
Z1176:Garem1	UTSW	18	21148325	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACATCCTTGAGGCTGCAAC -3'
(R):5'- TGATTAGTCAGTGCCGGGAG -3'

Sequencing Primer
(F):5'- TTGAGGCTGCAACCCAACG -3'
(R):5'- TGCTATGGCGTTCCTCGGAC -3'

Posted On

2019-10-17