Incidental Mutation 'R7534:Garem1'
ID 583477
Institutional Source Beutler Lab
Gene Symbol Garem1
Ensembl Gene ENSMUSG00000042680
Gene Name GRB2 associated regulator of MAPK1 subtype 1
Synonyms Garem, Fam59a, LOC381126
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock # R7534 (G1)
Quality Score 149.008
Status Validated
Chromosome 18
Chromosomal Location 21127201-21300138 bp(-) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) T to A at 21299916 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049260]
AlphaFold Q3UFT3
Predicted Effect probably benign
Transcript: ENSMUST00000049260
SMART Domains Protein: ENSMUSP00000048914
Gene: ENSMUSG00000042680

DomainStartEndE-ValueType
Pfam:CABIT 32 318 3.4e-79 PFAM
low complexity region 484 499 N/A INTRINSIC
low complexity region 512 518 N/A INTRINSIC
PDB:2DKZ|A 795 874 2e-40 PDB
Blast:SAM 808 875 2e-36 BLAST
SCOP:d1kw4a_ 812 873 4e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein which functions in the epidermal growth factor (EGF) receptor-mediated signaling pathway. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,741,023 R993Q probably benign Het
Aif1 A C 17: 35,171,414 M120R possibly damaging Het
Ank2 T C 3: 126,934,333 probably null Het
Ankrd11 A T 8: 122,894,410 I901N probably damaging Het
Apc T C 18: 34,316,962 S2304P probably damaging Het
AW551984 A T 9: 39,591,481 C632S probably benign Het
Bicra T C 7: 15,971,935 N1527S probably damaging Het
Cacna1d A G 14: 30,079,362 L1363P probably damaging Het
Cacna1g G A 11: 94,411,078 P2037S probably benign Het
Cdc27 A G 11: 104,508,414 L724S probably damaging Het
Cttnbp2 C T 6: 18,420,765 probably null Het
Dchs1 G A 7: 105,772,373 A280V probably benign Het
Dclk3 G A 9: 111,468,218 G277R probably benign Het
Ddr1 A G 17: 35,682,622 probably null Het
Dnah7c A C 1: 46,770,067 D3515A probably damaging Het
Elovl4 G A 9: 83,790,119 T49M probably damaging Het
Fam13b A T 18: 34,498,007 F40I probably damaging Het
Fancd2os T C 6: 113,597,640 H135R probably benign Het
Fer1l6 A G 15: 58,638,026 I1446V probably damaging Het
Fyb2 T A 4: 104,999,348 Y584* probably null Het
Galnt16 A T 12: 80,597,135 L442F probably damaging Het
Ggta1 C T 2: 35,402,428 R289Q probably damaging Het
Gm11564 T C 11: 99,815,521 T28A unknown Het
Hcn1 A G 13: 117,975,425 T642A unknown Het
Hhat A T 1: 192,726,304 L173H probably damaging Het
Hook1 T G 4: 96,017,597 I585S probably benign Het
Ighg1 A T 12: 113,329,729 S114T Het
Kmt2d G A 15: 98,852,018 P2598L unknown Het
Macc1 A T 12: 119,447,519 H674L probably benign Het
Mypn T C 10: 63,193,131 E51G probably benign Het
Olfr1012 A C 2: 85,759,459 L306V probably benign Het
Olfr134 T A 17: 38,175,297 M71K probably benign Het
Olfr862 A G 9: 19,884,176 V43A probably benign Het
Pnliprp2 T A 19: 58,775,142 S408T probably benign Het
Ppara A C 15: 85,777,726 Y56S probably benign Het
Ppp1r1a A G 15: 103,532,389 C114R probably benign Het
Pycard C T 7: 127,993,485 V57I probably damaging Het
Rin3 T G 12: 102,350,941 Y143D unknown Het
Slc12a7 A G 13: 73,764,068 probably benign Het
Slitrk3 C T 3: 73,050,107 R444H probably damaging Het
Ttf2 C T 3: 100,950,412 probably null Het
Ufsp2 T A 8: 45,980,324 I25N probably benign Het
Uqcrc2 A G 7: 120,641,689 T115A possibly damaging Het
Vmn2r43 T A 7: 8,255,231 R328* probably null Het
Vmn2r8 T A 5: 108,802,174 Y269F possibly damaging Het
Zbtb5 T C 4: 44,995,030 Y118C probably damaging Het
Zeb1 T C 18: 5,766,611 V374A probably damaging Het
Other mutations in Garem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Garem1 APN 18 21148657 missense probably damaging 1.00
IGL01588:Garem1 APN 18 21129797 missense probably damaging 0.99
IGL02171:Garem1 APN 18 21129241 missense probably damaging 0.98
IGL02270:Garem1 APN 18 21148450 missense probably damaging 1.00
IGL03149:Garem1 APN 18 21131466 missense probably damaging 1.00
R0136:Garem1 UTSW 18 21129991 missense probably damaging 0.96
R0285:Garem1 UTSW 18 21129612 missense probably benign
R0361:Garem1 UTSW 18 21299744 nonsense probably null
R1068:Garem1 UTSW 18 21168755 missense probably benign 0.00
R1537:Garem1 UTSW 18 21168874 splice site probably null
R1726:Garem1 UTSW 18 21148262 missense probably damaging 0.99
R1826:Garem1 UTSW 18 21129452 missense probably benign 0.00
R2140:Garem1 UTSW 18 21129374 missense probably damaging 1.00
R3714:Garem1 UTSW 18 21148890 missense probably damaging 1.00
R3937:Garem1 UTSW 18 21148806 nonsense probably null
R4362:Garem1 UTSW 18 21236115 missense possibly damaging 0.62
R4441:Garem1 UTSW 18 21168750 missense possibly damaging 0.92
R4747:Garem1 UTSW 18 21129943 missense probably benign
R4814:Garem1 UTSW 18 21148116 missense probably damaging 1.00
R4831:Garem1 UTSW 18 21129768 missense probably benign 0.01
R4838:Garem1 UTSW 18 21147893 missense probably benign 0.00
R5805:Garem1 UTSW 18 21148435 missense probably benign 0.04
R5963:Garem1 UTSW 18 21129430 missense probably benign 0.45
R5982:Garem1 UTSW 18 21148351 missense possibly damaging 0.64
R6134:Garem1 UTSW 18 21129824 missense probably benign 0.00
R6242:Garem1 UTSW 18 21129172 missense possibly damaging 0.72
R6453:Garem1 UTSW 18 21148739 missense probably damaging 0.99
R6485:Garem1 UTSW 18 21129837 missense probably benign 0.00
R6596:Garem1 UTSW 18 21148739 missense probably damaging 0.99
R6662:Garem1 UTSW 18 21148247 missense probably benign 0.45
R6883:Garem1 UTSW 18 21129712 missense probably benign
R6937:Garem1 UTSW 18 21147770 missense probably benign 0.00
R7027:Garem1 UTSW 18 21129994 missense probably benign
R7256:Garem1 UTSW 18 21148754 missense probably damaging 1.00
R7620:Garem1 UTSW 18 21129841 missense probably benign
R7869:Garem1 UTSW 18 21299700 missense probably damaging 1.00
R7963:Garem1 UTSW 18 21148787 missense probably damaging 0.98
R8058:Garem1 UTSW 18 21148564 missense probably damaging 1.00
R8953:Garem1 UTSW 18 21131331 critical splice donor site probably null
R9273:Garem1 UTSW 18 21148217 missense probably damaging 0.99
R9411:Garem1 UTSW 18 21236000 critical splice donor site probably null
R9475:Garem1 UTSW 18 21148313 missense probably benign 0.00
Z1176:Garem1 UTSW 18 21129792 missense probably damaging 1.00
Z1176:Garem1 UTSW 18 21148325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATCCTTGAGGCTGCAAC -3'
(R):5'- TGATTAGTCAGTGCCGGGAG -3'

Sequencing Primer
(F):5'- TTGAGGCTGCAACCCAACG -3'
(R):5'- TGCTATGGCGTTCCTCGGAC -3'
Posted On 2019-10-17