Incidental Mutation 'R7534:Pnliprp2'
ID583480
Institutional Source Beutler Lab
Gene Symbol Pnliprp2
Ensembl Gene ENSMUSG00000025091
Gene Namepancreatic lipase-related protein 2
SynonymsPLRP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R7534 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location58759723-58777533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58775142 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 408 (S408T)
Ref Sequence ENSEMBL: ENSMUSP00000026081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026081]
Predicted Effect probably benign
Transcript: ENSMUST00000026081
AA Change: S408T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026081
Gene: ENSMUSG00000025091
AA Change: S408T

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Lipase 31 367 4.1e-166 PFAM
LH2 370 482 7.49e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lipase that hydrolyzes galactolipids, the main components of plant membrane lipids. An allelic polymorphism in this gene results in both coding and non-coding variants; the reference genome represents the non-coding allele. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display deficient lipid absorbtion before weaning which results in growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,741,023 R993Q probably benign Het
Aif1 A C 17: 35,171,414 M120R possibly damaging Het
Ank2 T C 3: 126,934,333 probably null Het
Ankrd11 A T 8: 122,894,410 I901N probably damaging Het
Apc T C 18: 34,316,962 S2304P probably damaging Het
AW551984 A T 9: 39,591,481 C632S probably benign Het
Bicra T C 7: 15,971,935 N1527S probably damaging Het
Cacna1d A G 14: 30,079,362 L1363P probably damaging Het
Cacna1g G A 11: 94,411,078 P2037S probably benign Het
Cdc27 A G 11: 104,508,414 L724S probably damaging Het
Cttnbp2 C T 6: 18,420,765 probably null Het
Dchs1 G A 7: 105,772,373 A280V probably benign Het
Dclk3 G A 9: 111,468,218 G277R probably benign Het
Ddr1 A G 17: 35,682,622 probably null Het
Dnah7c A C 1: 46,770,067 D3515A probably damaging Het
Elovl4 G A 9: 83,790,119 T49M probably damaging Het
Fam13b A T 18: 34,498,007 F40I probably damaging Het
Fancd2os T C 6: 113,597,640 H135R probably benign Het
Fer1l6 A G 15: 58,638,026 I1446V probably damaging Het
Fyb2 T A 4: 104,999,348 Y584* probably null Het
Galnt16 A T 12: 80,597,135 L442F probably damaging Het
Garem1 T A 18: 21,299,916 probably benign Het
Ggta1 C T 2: 35,402,428 R289Q probably damaging Het
Gm11564 T C 11: 99,815,521 T28A unknown Het
Hcn1 A G 13: 117,975,425 T642A unknown Het
Hhat A T 1: 192,726,304 L173H probably damaging Het
Hook1 T G 4: 96,017,597 I585S probably benign Het
Ighg1 A T 12: 113,329,729 S114T Het
Kmt2d G A 15: 98,852,018 P2598L unknown Het
Macc1 A T 12: 119,447,519 H674L probably benign Het
Mypn T C 10: 63,193,131 E51G probably benign Het
Olfr1012 A C 2: 85,759,459 L306V probably benign Het
Olfr134 T A 17: 38,175,297 M71K probably benign Het
Olfr862 A G 9: 19,884,176 V43A probably benign Het
Ppara A C 15: 85,777,726 Y56S probably benign Het
Ppp1r1a A G 15: 103,532,389 C114R probably benign Het
Pycard C T 7: 127,993,485 V57I probably damaging Het
Rin3 T G 12: 102,350,941 Y143D unknown Het
Slc12a7 A G 13: 73,764,068 probably benign Het
Slitrk3 C T 3: 73,050,107 R444H probably damaging Het
Ttf2 C T 3: 100,950,412 probably null Het
Ufsp2 T A 8: 45,980,324 I25N probably benign Het
Uqcrc2 A G 7: 120,641,689 T115A possibly damaging Het
Vmn2r43 T A 7: 8,255,231 R328* probably null Het
Vmn2r8 T A 5: 108,802,174 Y269F possibly damaging Het
Zbtb5 T C 4: 44,995,030 Y118C probably damaging Het
Zeb1 T C 18: 5,766,611 V374A probably damaging Het
Other mutations in Pnliprp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Pnliprp2 APN 19 58760497 missense probably benign
IGL02739:Pnliprp2 APN 19 58760509 critical splice donor site probably null
IGL02881:Pnliprp2 APN 19 58771446 missense probably benign 0.01
IGL03411:Pnliprp2 APN 19 58760415 missense probably benign
R0140:Pnliprp2 UTSW 19 58766363 missense probably benign 0.00
R0558:Pnliprp2 UTSW 19 58774087 missense probably benign 0.00
R1873:Pnliprp2 UTSW 19 58763389 missense probably benign 0.00
R1874:Pnliprp2 UTSW 19 58763389 missense probably benign 0.00
R1875:Pnliprp2 UTSW 19 58763389 missense probably benign 0.00
R2382:Pnliprp2 UTSW 19 58768630 missense probably benign 0.00
R3893:Pnliprp2 UTSW 19 58766273 missense probably benign 0.19
R3915:Pnliprp2 UTSW 19 58760362 missense probably damaging 1.00
R4620:Pnliprp2 UTSW 19 58762286 missense possibly damaging 0.67
R4893:Pnliprp2 UTSW 19 58771421 missense probably benign 0.08
R4957:Pnliprp2 UTSW 19 58775145 missense possibly damaging 0.72
R4959:Pnliprp2 UTSW 19 58766318 missense probably benign 0.16
R4973:Pnliprp2 UTSW 19 58766318 missense probably benign 0.16
R5346:Pnliprp2 UTSW 19 58759800 missense probably benign
R6049:Pnliprp2 UTSW 19 58760452 missense possibly damaging 0.77
R6228:Pnliprp2 UTSW 19 58763442 critical splice donor site probably null
R6394:Pnliprp2 UTSW 19 58761598 missense probably benign
R6829:Pnliprp2 UTSW 19 58759873 missense probably benign
R7235:Pnliprp2 UTSW 19 58775227 missense probably benign 0.03
R7834:Pnliprp2 UTSW 19 58774159 missense probably benign 0.25
R7917:Pnliprp2 UTSW 19 58774159 missense probably benign 0.25
R8015:Pnliprp2 UTSW 19 58766282 missense probably damaging 0.99
X0058:Pnliprp2 UTSW 19 58774142 missense possibly damaging 0.59
Z1088:Pnliprp2 UTSW 19 58762325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCAGGCATCTTTCAACC -3'
(R):5'- ATGTCAGATACGTACTCTTTCCCG -3'

Sequencing Primer
(F):5'- GTCCTGTAGCAAACTTAGAGCTC -3'
(R):5'- GTCTTTACCGCGTTGCACTGTG -3'
Posted On2019-10-17