Mutagenetix > Incidental Mutation

Incidental Mutation 'R7535:Cdh20'

583483

Institutional Source

Beutler Lab

Gene Symbol

Cdh20

Ensembl Gene

ENSMUSG00000050840

Gene Name

cadherin 20

Synonyms

Cdh7

MMRRC Submission

Accession Numbers

Genbank: NM_011800

Essential gene?

Possibly non essential (E-score: 0.265) question?

Stock #

R7535 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

104768529-104995481 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 104975043 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 486 (D486E)

Ref Sequence

ENSEMBL: ENSMUSP00000052078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062528]

AlphaFold

Q9Z0M3

Predicted Effect

probably damaging
Transcript: ENSMUST00000062528
AA Change: D486E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000052078
Gene: ENSMUSG00000050840
AA Change: D486E

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
CA	82	163	1.01e-15	SMART
CA	187	272	1.35e-30	SMART
CA	296	388	1.98e-14	SMART
CA	411	492	1.61e-23	SMART
CA	515	602	3.9e-13	SMART
transmembrane domain	620	642	N/A	INTRINSIC
Pfam:Cadherin_C	645	793	2.6e-49	PFAM

Meta Mutation Damage Score

0.7669

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (82/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type II classical cadherin from the cadherin superfamily and one of three cadherin 7-like genes located in a cluster on chromosome 18. The encoded membrane protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Since disturbance of intracellular adhesion is a prerequisite for invasion and metastasis of tumor cells, cadherins are considered prime candidates for tumor suppressor genes. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610037L13Rik	T	G	4: 107,894,900	S159A	probably benign	Het
Abca7	T	A	10: 80,001,629	L449Q	probably benign	Het
Agtpbp1	T	C	13: 59,504,253	T415A	probably benign	Het
Akt3	A	T	1: 177,097,034	V165D	probably damaging	Het
Cbr2	T	A	11: 120,729,802	I219F	probably damaging	Het
Cenpe	A	G	3: 135,243,762	S103G	possibly damaging	Het
Chd4	T	A	6: 125,128,873	S1818T	probably benign	Het
Chst5	T	C	8: 111,890,163	D275G	probably damaging	Het
Clca1	A	G	3: 145,018,567	I244T	probably damaging	Het
Cyp2c54	A	G	19: 40,070,272	Y239H	probably benign	Het
Ddx25	A	G	9: 35,543,655	F446L	possibly damaging	Het
Dgkb	T	C	12: 38,136,647	L265P	probably damaging	Het
Dis3	A	G	14: 99,089,979	S363P	probably benign	Het
Disp3	T	C	4: 148,242,866	E1187G	probably damaging	Het
Dopey2	G	A	16: 93,806,361	G2061R	probably damaging	Het
Dsp	T	C	13: 38,192,789	S1517P	probably benign	Het
Epg5	T	A	18: 78,032,926	V2513E	probably benign	Het
Fryl	T	A	5: 73,098,196	T831S	probably benign	Het
Gm6309	A	T	5: 146,168,290	V271D	probably damaging	Het
H2-M2	G	T	17: 37,482,637	S159R	probably benign	Het
Helq	A	G	5: 100,790,133		probably null	Het
Herc1	G	C	9: 66,474,853	D3621H	probably damaging	Het
Hsd11b2	A	T	8: 105,519,123	I87F	probably damaging	Het
Ice2	A	G	9: 69,432,078	N959S	probably damaging	Het
Ifi47	T	A	11: 49,096,625	D406E	probably damaging	Het
Ifit3	T	G	19: 34,587,880	S275R	probably damaging	Het
Insl5	C	A	4: 103,018,198	K118N	probably damaging	Het
Irf7	A	T	7: 141,264,637	F158I	probably benign	Het
Kat2b	T	C	17: 53,624,403	L143P	probably damaging	Het
Klk1b1	A	T	7: 43,970,322	N102Y	probably damaging	Het
Krt13	C	T	11: 100,117,998	G410S	unknown	Het
Larp6	A	T	9: 60,724,154	T70S	probably benign	Het
Lrrc37a	T	C	11: 103,501,857	E914G	possibly damaging	Het
Mindy4	T	C	6: 55,297,753		probably null	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myom2	A	G	8: 15,117,679	Y1088C	probably damaging	Het
Mysm1	T	C	4: 94,952,215	N655D	probably benign	Het
Nbas	T	A	12: 13,279,389	S112T	probably damaging	Het
Neb	A	G	2: 52,165,103		probably null	Het
Noxred1	G	A	12: 87,233,432	A42V	probably benign	Het
Olfm5	G	A	7: 104,154,237	P340S	possibly damaging	Het
Olfr1031	T	A	2: 85,991,901	V28E	probably benign	Het
Olfr1039	A	G	2: 86,131,264	V133A	probably benign	Het
Olfr1505	A	G	19: 13,919,085	K22E	probably benign	Het
Olfr167	T	C	16: 19,514,794	T281A	probably damaging	Het
Olfr749	G	A	14: 50,736,665	P166S	probably benign	Het
Pccb	A	T	9: 100,994,562		probably null	Het
Pnn	T	A	12: 59,072,137	V502E	probably benign	Het
Pole2	A	T	12: 69,222,429	I98K	probably benign	Het
Ptpn18	G	A	1: 34,473,364	D417N	possibly damaging	Het
Rasgrp4	A	G	7: 29,139,059	K111E	probably benign	Het
Rbbp6	G	A	7: 122,990,143	M351I	probably benign	Het
Rgs19	T	G	2: 181,691,308	H53P	probably damaging	Het
Rin1	A	T	19: 5,052,536	T369S	probably benign	Het
Rnaset2b	G	A	17: 6,991,739	E135K	possibly damaging	Het
Rprd2	G	A	3: 95,776,587	P379S	probably damaging	Het
Sbno1	A	G	5: 124,413,279	L47P	possibly damaging	Het
Slamf6	T	A	1: 171,919,758	L29Q	unknown	Het
Slc16a14	T	C	1: 84,913,122	Y154C	probably damaging	Het
Slc22a29	A	G	19: 8,169,978	F340S	probably damaging	Het
Slc6a4	T	G	11: 77,015,150	I259S	possibly damaging	Het
Smarca4	G	A	9: 21,647,625	V651I	possibly damaging	Het
Susd5	C	T	9: 114,064,040	A62V	possibly damaging	Het
Syt1	T	A	10: 108,627,422		probably null	Het
Taf10	T	C	7: 105,740,910	I218T	probably benign	Het
Tas1r1	C	A	4: 152,028,362	V745F	probably benign	Het
Tas2r125	C	A	6: 132,910,324	T225K	probably damaging	Het
Tcp11l2	G	T	10: 84,594,659	R216L	possibly damaging	Het
Tnks1bp1	C	T	2: 85,063,280	Q1184*	probably null	Het
Treml2	T	A	17: 48,302,819	V93D	probably damaging	Het
Trim11	G	A	11: 58,982,065	E192K	probably damaging	Het
Trim43a	A	G	9: 88,588,148	K336E	probably damaging	Het
Tspan33	T	A	6: 29,717,589	I268N	possibly damaging	Het
Tstd2	C	T	4: 46,116,960	C458Y	probably damaging	Het
Ttc6	A	G	12: 57,576,519	S235G	probably benign	Het
Usp29	A	C	7: 6,961,220	T21P	possibly damaging	Het
Usp36	A	T	11: 118,262,046	S1084T	possibly damaging	Het
Vps39	T	A	2: 120,324,695	N550I	probably damaging	Het
Wdr47	A	G	3: 108,629,711	I572V	probably benign	Het
Zfp112	A	T	7: 24,126,710	Y705F	probably damaging	Het
Zfp282	A	G	6: 47,904,944	T522A	probably benign	Het
Zfp292	T	C	4: 34,811,487	D524G	probably benign	Het
Zfp90	A	T	8: 106,424,268	K204N	possibly damaging	Het
Zmym2	T	C	14: 56,957,079	S1265P	probably damaging	Het

Other mutations in Cdh20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Cdh20	APN	1	104953887	missense	probably benign	0.05
IGL00743:Cdh20	APN	1	104947428	missense	probably benign	0.06
IGL00848:Cdh20	APN	1	104934256	missense	probably benign
IGL01393:Cdh20	APN	1	104934244	missense	probably benign
IGL01396:Cdh20	APN	1	104947429	missense	possibly damaging	0.59
IGL01485:Cdh20	APN	1	104934107	missense	probably benign	0.05
IGL01612:Cdh20	APN	1	104994170	missense	probably benign	0.02
IGL01947:Cdh20	APN	1	104993924	missense	possibly damaging	0.91
IGL01967:Cdh20	APN	1	104941037	missense	probably damaging	1.00
IGL02226:Cdh20	APN	1	104954091	splice site	probably benign
IGL02318:Cdh20	APN	1	104954039	missense	probably null	0.03
IGL02326:Cdh20	APN	1	104975039	missense	probably damaging	0.97
IGL02798:Cdh20	APN	1	104947465	missense	probably damaging	0.97
IGL02963:Cdh20	APN	1	104934098	start codon destroyed	probably null	0.66
IGL03081:Cdh20	APN	1	104941257	missense	probably damaging	1.00
3-1:Cdh20	UTSW	1	104947420	missense	possibly damaging	0.84
BB002:Cdh20	UTSW	1	104984748	missense	probably damaging	0.99
BB012:Cdh20	UTSW	1	104984748	missense	probably damaging	0.99
IGL02991:Cdh20	UTSW	1	104934247	missense	probably benign
R0178:Cdh20	UTSW	1	104975051	missense	possibly damaging	0.82
R1114:Cdh20	UTSW	1	104979014	missense	probably damaging	0.96
R1401:Cdh20	UTSW	1	104947497	missense	possibly damaging	0.65
R1502:Cdh20	UTSW	1	104954030	missense	probably benign	0.06
R1764:Cdh20	UTSW	1	104934345	splice site	probably benign
R2198:Cdh20	UTSW	1	104947322	critical splice acceptor site	probably null
R2279:Cdh20	UTSW	1	104947414	missense	probably damaging	1.00
R2419:Cdh20	UTSW	1	104975015	missense	possibly damaging	0.92
R2897:Cdh20	UTSW	1	104947474	missense	probably damaging	1.00
R4243:Cdh20	UTSW	1	104942143	missense	probably damaging	1.00
R4244:Cdh20	UTSW	1	104942143	missense	probably damaging	1.00
R4349:Cdh20	UTSW	1	104979089	missense	probably damaging	1.00
R4350:Cdh20	UTSW	1	104979089	missense	probably damaging	1.00
R4352:Cdh20	UTSW	1	104979089	missense	probably damaging	1.00
R4353:Cdh20	UTSW	1	104979089	missense	probably damaging	1.00
R4719:Cdh20	UTSW	1	104934310	missense	probably damaging	0.97
R4754:Cdh20	UTSW	1	104984685	missense	probably damaging	0.99
R4795:Cdh20	UTSW	1	104941264	missense	probably damaging	1.00
R4796:Cdh20	UTSW	1	104941264	missense	probably damaging	1.00
R4955:Cdh20	UTSW	1	104984803	missense	probably damaging	1.00
R5056:Cdh20	UTSW	1	104953997	missense	probably benign	0.00
R5127:Cdh20	UTSW	1	104947348	missense	probably damaging	1.00
R5269:Cdh20	UTSW	1	104934157	missense	possibly damaging	0.67
R5563:Cdh20	UTSW	1	104947357	missense	probably benign	0.29
R5634:Cdh20	UTSW	1	104975075	missense	probably damaging	0.97
R5708:Cdh20	UTSW	1	104984910	missense	probably damaging	1.00
R5822:Cdh20	UTSW	1	104934098	start codon destroyed	probably null	0.49
R5933:Cdh20	UTSW	1	104984671	missense	probably damaging	1.00
R6109:Cdh20	UTSW	1	104994014	missense	probably damaging	1.00
R6521:Cdh20	UTSW	1	104942134	missense	probably damaging	1.00
R6911:Cdh20	UTSW	1	104984686	missense	possibly damaging	0.95
R7169:Cdh20	UTSW	1	104947353	missense	possibly damaging	0.91
R7207:Cdh20	UTSW	1	104993977	missense	probably damaging	0.98
R7208:Cdh20	UTSW	1	104954071	missense	possibly damaging	0.63
R7297:Cdh20	UTSW	1	104970873	missense	probably benign
R7587:Cdh20	UTSW	1	104941279	missense	probably damaging	1.00
R7748:Cdh20	UTSW	1	104941299	missense	probably damaging	1.00
R7879:Cdh20	UTSW	1	104947322	critical splice acceptor site	probably null
R7915:Cdh20	UTSW	1	104934173	missense	probably benign	0.15
R7925:Cdh20	UTSW	1	104984748	missense	probably damaging	0.99
R8257:Cdh20	UTSW	1	104994237	missense	probably benign	0.25
R8444:Cdh20	UTSW	1	104970858	missense	probably benign	0.16
R8546:Cdh20	UTSW	1	104934044	start gained	probably benign
R8870:Cdh20	UTSW	1	104945323	missense	probably damaging	0.99
R9310:Cdh20	UTSW	1	104947336	missense	probably damaging	1.00
R9542:Cdh20	UTSW	1	104947342	missense	probably damaging	1.00
R9602:Cdh20	UTSW	1	104941098	missense	probably benign	0.07
R9664:Cdh20	UTSW	1	104934340	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- AACACATGTCCTATGCGCG -3'
(R):5'- CATACTTTCTGGTGTGGACATGATG -3'

Sequencing Primer
(F):5'- ACATGTCCTATGCGCGTGTTATC -3'
(R):5'- TTCCATGGCCTCTGAAAGAG -3'

Posted On

2019-10-17